AMCG00005837



Basic Information


Item Value
gene id AMCG00005837
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030142.1
NCBI id CM030142.1
chromosome length 21087710
location 10696777 ~ 10697001 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>AMCG00005837
ATGGCCCCGCTCAGCGCCGCCTCAGACCCGCGTCACATGGGCAGCGAGCGCTTCAGACCCGCGTCACATGGGCGCCGAGCTCCGGAGCGCCTCGTACATTTTGTTAGTGTCGGAGCGGCGGACAGCGATGGTGGATCGACCCGAACTGCAGCCAGGATCTACAGTTTAACATCTGGAGCAGCACCAGCGGGGCAGACATCGGCATCAACACGAACCGTGTCGTGA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
AMCG00005837 True 225 mRNA 0.63 1 10696777 10697001
Loading

Neighbor


gene id symbol gene type direction distance location
AMCG00005803 NA coding upstream 63345 10626449 ~ 10633432 (+)
AMCG00005804 LOC106613805,LOC101170792,LOC103364385 coding upstream 73768 10615882 ~ 10623009 (+)
AMCG00005857 NA coding upstream 172946 10520856 ~ 10523831 (+)
AMCG00005856 NA coding upstream 189485 10503578 ~ 10507292 (+)
AMCG00005858 NA coding upstream 193955 10502507 ~ 10502822 (+)
AMCG00005836 aes,chico,LOC103379965,LOC106574496,LOC107558286 coding downstream 4009 10701010 ~ 10712559 (+)
AMCG00005833 NA coding downstream 148535 10845536 ~ 10846858 (+)
AMCG00005826 sirt6,LOC107667852 coding downstream 185618 10882619 ~ 10886247 (+)
AMCG00005867 eef2b,ef2,LOC106613766,LOC107552698 coding downstream 209356 10906357 ~ 10912672 (+)
AMCG00005868 NA coding downstream 222947 10919948 ~ 10923547 (+)
G154583 NA non-coding upstream 28516 10667998 ~ 10668261 (+)
G154574 NA non-coding upstream 120340 10575979 ~ 10576437 (+)
G154505 NA non-coding upstream 170725 10523967 ~ 10526052 (+)
G154473 NA non-coding upstream 206923 10419906 ~ 10489854 (+)
G154447 NA non-coding upstream 364683 10285514 ~ 10332094 (+)
G154722 NA non-coding downstream 300648 10997649 ~ 10999389 (+)
G154775 NA non-coding downstream 477394 11174395 ~ 11180237 (+)
G154815 dot1l non-coding downstream 665004 11362005 ~ 11362233 (+)
G154816 NA non-coding downstream 673423 11370424 ~ 11370912 (+)
G154831 NA non-coding downstream 681779 11378780 ~ 11379289 (+)
G154499 NA other upstream 180387 10512504 ~ 10516390 (+)
G154486 NA other upstream 225146 10470543 ~ 10471631 (+)
AMCG00005821 NA other upstream 227371 10462537 ~ 10469406 (+)
AMCG00005929 NA other upstream 340533 10267273 ~ 10356244 (+)
AMCG00005834 LOC108271164,LOC108430094,LOC107393192,LOC107719559,LOC107699414 other downstream 24751 10721752 ~ 10736626 (+)
G154636 LOC108435919,LOC108271001 other downstream 216396 10913397 ~ 10915729 (+)
AMCG00005840 LOC100304646,LOC107384145 other downstream 309797 11006798 ~ 11010354 (+)
G154756 NA other downstream 386160 11083161 ~ 11086011 (+)
G154798 NA other downstream 622963 11319964 ~ 11361770 (+)

Expression


AMCG00005837 Expression in all Baseline Samples

Bar chart with 16 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 150.
End of interactive chart.

AMCG00005837 Expression in each Bioproject

Bar chart with 7 bars.
AMCG00005837 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network