AMCG00006126 (wdr18,LOC106613619)


Basic Information

Item Value
gene id AMCG00006126
gene name wdr18,LOC106613619
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030142.1
NCBI id CM030142.1
chromosome length 21087710
location 16903593 ~ 16905803 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00006126
ATGTCTGCGCCCATGGAAGTCGTGGTCTGCTCCGACTCCTCCGGTCAGCTGTGTAACTGTGCGGTTTACGAGCTCCATTCTGGGACTAACTTGCTCTCGTACCGTGGTGGTAATACCTCGGCTCGGTCTCTGGCTGTCCTGAATGGGGAACACATTTTGGGAGCGCAAATCGGCAAGAATTACATCAACGTGTGGGAGGTCCAGAGAAAGGACCAGTTGCAACAGAAGATTGTGTGTCCAGGGATTGTGACCTGCCTCACCACTTCCCCAAATGGATTCTACCTGCTGGTTGGAATTGCTGAGGCCATCTATGTGTGGGAGGTGTCCACGGGCAGACTGTTGGCAGTCCTCAGCCGCCACTACCAGGACCTGACCTGTCTCTGCTTCACTGATGACAGCAGCCACTTTATCTCGGGGGGCAAAGACAACCTGGCGCTGGTCTGGAGCCTGATT

Function

symbol description
wdr18 Acts upstream of or within Kupffer's vesicle development and determination of left/right symmetry. Predicted to be located in dynein axonemal particle. Predicted to be part of Rix1 complex and nuclear pre-replicative complex. Is expressed in Kupffer's vesicle; forerunner cell group; liver; and pancreas. Orthologous to human WDR18 (WD repeat domain 18).

NR:

description
PREDICTED: WD repeat-containing protein 18

GO:

id name namespace
GO:0070121 Kupffer's vesicle development biological_process
GO:0007368 determination of left/right symmetry biological_process

KEGG:

id description
K14829 IPI3; pre-rRNA-processing protein IPI3

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00006126 True 453 mRNA 0.55 3 16903593 16905803

Neighbor

gene id symbol gene type direction distance location
AMCG00006129 NA coding downstream 58661 16835879 ~ 16844932 (-)
AMCG00006145 NA coding downstream 154198 16722210 ~ 16749395 (-)
AMCG00006144 med16,LOC106613614 coding downstream 199668 16694712 ~ 16703925 (-)
AMCG00006147 NA coding downstream 222125 16660952 ~ 16681468 (-)
AMCG00006146 NA coding downstream 242677 16648022 ~ 16660916 (-)
AMCG00006128 NA coding upstream 17092 16922895 ~ 16941137 (-)
AMCG00006132 NA coding upstream 74742 16980545 ~ 17008274 (-)
AMCG00006131 NA coding upstream 116466 17022269 ~ 17022594 (-)
AMCG00006133 NA coding upstream 117225 17023028 ~ 17028378 (-)
AMCG00006153 NA coding upstream 131024 17036827 ~ 17051752 (-)
G156344 NA non-coding downstream 227546 16674798 ~ 16676047 (-)
G156228 NA non-coding downstream 832065 16066669 ~ 16071528 (-)
G156225 NA non-coding downstream 840521 16062733 ~ 16063072 (-)
G156207 NA non-coding downstream 903554 15994787 ~ 16000039 (-)
G156203 NA non-coding downstream 956066 15947208 ~ 15947527 (-)
G156668 NA non-coding upstream 1226526 18132329 ~ 18137505 (-)
G156670 NA non-coding upstream 1232716 18138519 ~ 18144775 (-)
G156696 NA non-coding upstream 1527803 18433606 ~ 18434245 (-)
G156716 NA non-coding upstream 1626259 18532062 ~ 18532447 (-)
G156717 NA non-coding upstream 1627380 18533183 ~ 18538243 (-)
G156341 NA other downstream 222821 16651540 ~ 16680772 (-)
AMCG00006118 NA other downstream 381904 16505364 ~ 16521689 (-)
AMCG00006083 NA other downstream 441428 16454284 ~ 16462165 (-)
G156206 klhl26,LOC107680559,LOC107597147 other downstream 946503 15954076 ~ 15957090 (-)
G156088 rps15,LOC107680474,LOC107685215,LOC107578086 other downstream 1411951 15433432 ~ 15491642 (-)
AMCG00006127 NA other upstream 42194 16947997 ~ 16963650 (-)
G156907 NA other upstream 2369397 19275200 ~ 19293820 (-)
AMCG00006201 LOC105903982,LOC108433090,LOC106600049,LOC105020399,LOC107384124,LOC106569512 other upstream 2543128 19448931 ~ 19463205 (-)
G157059 NA other upstream 3803996 20709799 ~ 20712216 (-)

Expression


Co-expression Network