G152198


Basic Information

Item Value
gene id G152198
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030142.1
NCBI id CM030142.1
chromosome length 21087710
location 1461724 ~ 1461939 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU191632
CGCTCGTCTCTTGTCTCTCCAGGAATGAGCAGCGATGGCCGGATCCGCCAGCGAGGAGAAAACCTTCCGCAGGTTCCTGGAGGTCTTCCTCCGAGAGATGAGAGGGGCTCTGGGGGACGACGAGCCGCTGCCGCTGCGCCCCTTGCCGGACCTGGTCTCGGAGGACGAGGTGGAGGGCGAGTGTCTGGACCTGTGTCTCCAGCATCTCTGCAAATA

Function

GO: NA

KEGG:

id description
ko04974 Protein digestion and absorption

RNA

RNA id representative length rna type GC content exon number start site end site
TU191632 True 216 lncRNA 0.63 1 1461724 1461939

Neighbor

gene id symbol gene type direction distance location
AMCG00005422 trim37,LOC103132205,LOC106941548 coding upstream 36388 1408433 ~ 1425336 (+)
AMCG00005425 NA coding upstream 55187 1403046 ~ 1406537 (+)
AMCG00005424 LOC106567664 coding upstream 59023 1388688 ~ 1402701 (+)
AMCG00005413 kctd7 coding upstream 77134 1381741 ~ 1384590 (+)
AMCG00005416 LOC108240947,LOC106533470 coding upstream 102201 1342760 ~ 1359523 (+)
AMCG00005423 NA coding downstream 7237 1469176 ~ 1480171 (+)
AMCG00005437 NA coding downstream 24274 1486213 ~ 1490622 (+)
AMCG00005436 smg8 coding downstream 29532 1491471 ~ 1496565 (+)
AMCG00005435 NA coding downstream 34913 1496852 ~ 1506717 (+)
AMCG00005432 NA coding downstream 95901 1557840 ~ 1567204 (+)
G152196 NA non-coding upstream 2977 1458154 ~ 1458747 (+)
G152111 NA non-coding upstream 207765 1245031 ~ 1253959 (+)
G152053 NA non-coding upstream 404329 1057185 ~ 1057395 (+)
G152040 NA non-coding upstream 447344 1014078 ~ 1014380 (+)
G151978 NA non-coding upstream 770788 690659 ~ 690936 (+)
G152397 NA non-coding downstream 793426 2255365 ~ 2323345 (+)
G152644 NA non-coding downstream 1610011 3071950 ~ 3090655 (+)
G152655 NA non-coding downstream 1721882 3183821 ~ 3186988 (+)
G152656 NA non-coding downstream 1737393 3199332 ~ 3200187 (+)
G152657 NA non-coding downstream 1798271 3260210 ~ 3260429 (+)
AMCG00005418 NA other upstream 82422 1376468 ~ 1379302 (+)
G152159 NA other upstream 93768 1367014 ~ 1367956 (+)
G151969 NA other upstream 924361 536751 ~ 537363 (+)
G151967 NA other upstream 1061859 398925 ~ 399865 (+)
AMCG00005434 NA other downstream 47563 1509502 ~ 1517580 (+)
G152267 NA other downstream 284021 1745960 ~ 1748934 (+)
G152337 NA other downstream 337872 1799811 ~ 1803903 (+)
AMCG00005429 ywhae,LOC106567579,LOC105005922 other downstream 467516 1929455 ~ 1946800 (+)
AMCG00005481 dynll2a,LOC107554284,LOC103397138 other downstream 1041971 2503910 ~ 2510676 (+)

Expression


Co-expression Network