G153141 (ruvbl2,LOC107664527,LOC107597476,LOC107677411,LOC107587476,LOC107722783)


Basic Information

Item Value
gene id G153141
gene name ruvbl2,LOC107664527,LOC107597476,LOC107677411,LOC107587476,LOC107722783
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030142.1
NCBI id CM030142.1
chromosome length 21087710
location 5351353 ~ 5352345 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU192843
CGAGAAAAGCGCCAGGAAGCCCTGCGTTCGGCTGTTGATGACGTCGATTTCGTGCAGAGACACCGTGTGGACGACCTCCTTGCGCTTCTGTAGCTCTCCCTCCGGACACTGGACGAACTGCGTCTGCGCTCCCATGGCGTCATAGTCTCGGGCTCTCGTGAAGGAGCGTCCCAGCTTGCTGATTTTGCCTGTGGCTTTATCGATGGTGATGACGTCCCCTGCCTGGACACGTTCCTTACTCAGGCTCTCGATCATTTTGGTCCCCAGGTCATAGATTGTCTCCATTTCGGTTGTTTTCAGTGTCAGTTTGCCCACCTTGGAACCCGTGCCCGTCGCCGGCCTGTCGATCTGAATTTCCACAACCTCTCCCTCGATGATCT

Function

symbol description
ruvbl2 Enables ATP hydrolysis activity. Acts upstream of or within several processes, including cilium assembly; epithelial cilium movement involved in extracellular fluid movement; and regulation of heart growth. Predicted to be located in dynein axonemal particle and nucleus. Predicted to be part of R2TP complex and nuclear lumen. Is expressed in central nervous system; neural tube; posterior lateral line; and pronephric duct. Orthologous to human RUVBL2 (RuvB like AAA ATPase 2).

NR:

description
PREDICTED: ruvB-like 2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU192843 True 380 lncRNA 0.56 4 5351353 5352345

Neighbor

gene id symbol gene type direction distance location
AMCG00005616 NA coding downstream 3085 5344509 ~ 5348268 (-)
AMCG00005620 NA coding downstream 13825 5317898 ~ 5337528 (-)
AMCG00005617 NA coding downstream 38379 5310659 ~ 5312974 (-)
AMCG00005618 derl2,LOC106567674,LOC107735937,LOC107579789,LOC107093934,LOC107580170 coding downstream 41421 5306588 ~ 5309932 (-)
AMCG00005619 rabep1,LOC106603450 coding downstream 54800 5283576 ~ 5296553 (-)
AMCG00005574 LOC106602867 coding upstream 20116 5372461 ~ 5405899 (-)
AMCG00005576 LOC106602867,LOC107597455 coding upstream 91816 5444161 ~ 5444610 (-)
AMCG00005575 NA coding upstream 108574 5460919 ~ 5467836 (-)
AMCG00005625 NA coding upstream 155907 5508252 ~ 5513394 (-)
AMCG00005606 NA coding upstream 314515 5666860 ~ 5709455 (-)
G152942 NA non-coding downstream 819621 4531440 ~ 4531732 (-)
G152915 NA non-coding downstream 1050955 4292030 ~ 4300398 (-)
G152894 NA non-coding downstream 1091041 4257221 ~ 4260312 (-)
G152853 NA non-coding downstream 1357832 3989919 ~ 3993521 (-)
G152815 NA non-coding downstream 1558909 3788208 ~ 3792444 (-)
G153143 NA non-coding upstream 1008 5353353 ~ 5355697 (-)
G153178 NA non-coding upstream 134964 5487309 ~ 5489599 (-)
G153236 NA non-coding upstream 296013 5648358 ~ 5648709 (-)
G153248 dhx33 non-coding upstream 389147 5741492 ~ 5748572 (-)
G153272 NA non-coding upstream 448303 5800648 ~ 5800906 (-)
G153130 NA other downstream 49155 5300769 ~ 5302198 (-)
AMCG00005539 NA other downstream 1058482 4284717 ~ 4292871 (-)
AMCG00005560 LOC106568075,LOC104946632,LOC106603282 other downstream 1482144 3850136 ~ 3869209 (-)
AMCG00005525 LOC106567758 other downstream 1718641 3606961 ~ 3632712 (-)
G152645 NA other downstream 2260639 3071860 ~ 3090714 (-)
G153342 NA other upstream 728890 6081235 ~ 6082866 (-)
AMCG00005628 LOC107090330,LOC102220786 other upstream 879814 6232159 ~ 6234028 (-)
AMCG00005674 NA other upstream 1137910 6490255 ~ 6496571 (-)
AMCG00005685 NA other upstream 1756873 7109218 ~ 7145807 (-)
G153733 auts2 other upstream 2433209 7785554 ~ 7788321 (-)

Expression


Co-expression Network