AMCG00006443 (grm8,grm8a,LOC108412277)


Basic Information

Item Value
gene id AMCG00006443
gene name grm8,grm8a,LOC108412277
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030134.1
NCBI id CM030134.1
chromosome length 29342575
location 4570524 ~ 4571515 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00006443
ATGGCCGGGGACAAGAGGCGCTCTGTTTCCTGCCACTGCTTCTTCCTGCTCACGGCCAAGTGCTGCTGGCTGTTGACCTCCATGCAGAAGACGGAGGCGCAGGAGCACGCCCACTCCATCCGCCTGGAAGGTGATATCATCCTCGGAGGACTGTTCCCCGTGCACTCCCGGGGCGAGCGTGGGATAGCGTGTGGGGAGTTAAAGAAGGAGAAGGGCATCCACCGACTGGAGGCCATGCTGTACGCCATTGACCAGATCAACAAGGACCCGGACCTCCTCCCCAATGTGACCCTGGGTGTCCGCATCCTGGACACCTGCTCCCGGGACACCTACGCCCTGGAGCAGTCGCTGACCTTCGTGCAGGCGCTGATCGAGAAGGACGCGTCTGACGTCAGGTGTGCCAATGGGGACCCGCCCATCTTTGCCAAACCCGACAAGATCATAGGAGTAATAGGGGCGGCCGCCAGTTCCGTGTCGATCATGGTTGCTAACATATTGAGACTTTTTAAGCCGAGGCTGCGGATTGCGGTGGCAGTCGTGTCCCGGGGACCGATTTTGTGGTACCTGCCACCTGCTGGACTGTGA

Function

symbol description
grm8a Predicted to enable group III metabotropic glutamate receptor activity. Predicted to be involved in G protein-coupled glutamate receptor signaling pathway and regulation of glutamatergic synaptic transmission. Predicted to act upstream of or within G protein-coupled receptor signaling pathway. Predicted to be located in plasma membrane. Predicted to be integral component of membrane. Predicted to be integral component of plasma membrane. Is expressed in brain and retinal neural layer. Human ortholog(s) of this gene implicated in attention deficit hyperactivity disorder; autistic disorder; and schizophrenia. Orthologous to human GRM8 (glutamate metabotropic receptor 8).
grm8 Enables G protein-coupled receptor activity and glutamate receptor activity. Involved in adenylate cyclase-inhibiting G protein-coupled glutamate receptor signaling pathway. Predicted to be located in presynaptic membrane. Predicted to be active in GABA-ergic synapse and glutamatergic synapse. Predicted to be integral component of presynaptic active zone membrane. Implicated in attention deficit hyperactivity disorder; autistic disorder; and schizophrenia. Biomarker of multiple sclerosis.

NR:

description
PREDICTED: metabotropic glutamate receptor 8

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00006443 True 585 mRNA 0.60 2 4570524 4571515

Neighbor

gene id symbol gene type direction distance location
AMCG00006442 NA coding upstream 8449 4542112 ~ 4562075 (+)
AMCG00006444 NA coding upstream 54441 4496406 ~ 4516083 (+)
AMCG00006446 NA coding upstream 74150 4488497 ~ 4496374 (+)
AMCG00006438 NA coding upstream 120055 4441961 ~ 4450469 (+)
AMCG00006433 NA coding upstream 210328 4351652 ~ 4360196 (+)
AMCG00006450 LOC107389496,LOC106561032 coding downstream 43677 4615192 ~ 4632996 (+)
AMCG00006449 LOC105007228,LOC106561032,LOC107584025 coding downstream 91987 4663502 ~ 4678336 (+)
AMCG00006451 grm8 coding downstream 128151 4699666 ~ 4706437 (+)
AMCG00006453 NA coding downstream 349503 4921018 ~ 4926780 (+)
AMCG00006454 NA coding downstream 355328 4926843 ~ 4930909 (+)
G109721 NA non-coding upstream 49275 4518917 ~ 4521249 (+)
G109713 NA non-coding upstream 97516 4468391 ~ 4473008 (+)
G109655 NA non-coding upstream 193147 4374148 ~ 4377377 (+)
G109662 tubb,LOC108432309 non-coding upstream 235074 4334323 ~ 4335450 (+)
G109660 NA non-coding upstream 241246 4328869 ~ 4329278 (+)
G109767 NA non-coding downstream 351617 4923132 ~ 4924794 (+)
G109779 NA non-coding downstream 446574 5018089 ~ 5020403 (+)
G109780 NA non-coding downstream 449781 5021296 ~ 5022178 (+)
G109786 NA non-coding downstream 472901 5044416 ~ 5044633 (+)
G109837 NA non-coding downstream 780941 5352456 ~ 5353170 (+)
AMCG00006445 NA other upstream 42786 4524806 ~ 4527738 (+)
G109714 NA other upstream 92954 4476934 ~ 4477570 (+)
AMCG00006413 NA other upstream 402572 4159523 ~ 4167952 (+)
G109570 NA other upstream 414775 4152816 ~ 4155749 (+)
G109538 NA other upstream 606528 3963597 ~ 3963996 (+)
G109781 NA other downstream 453380 5024895 ~ 5025906 (+)
G109795 wasl,wasla,LOC105018628 other downstream 509366 5080881 ~ 5098698 (+)
AMCG00006460 wasl,wasla,LOC107698525 other downstream 522756 5094271 ~ 5107022 (+)
AMCG00006459 NA other downstream 555842 5127357 ~ 5134715 (+)
G110023 NA other downstream 1407547 5979062 ~ 5982909 (+)

Expression


Co-expression Network