AMCG00006519


Basic Information

Item Value
gene id AMCG00006519
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030134.1
NCBI id CM030134.1
chromosome length 29342575
location 7651790 ~ 7652194 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00006519
ATGAGAATGTCCCTGGCACAGAGAGTGCTGCTCACCTGGGTCTTCACTCTGGTCTTCCTCATCATGCTGGTGCTGAAGCTGGACGAGAAGGTGGGCTGGAACTGGTTCCTCATCTTCCTGCCCGTGTGGATCTTCGACGCCATCCTGCTGCTCATGCTGGCGGTGAAGATGGCGGGCCGCTGCAAGCCGGGCTACGACCCCCGCCACGGCTCGCAGAACCTGAAGAAGAAGGCCTGGTACCTGGTGGCCATGCTGCTCAAGCTGGCCTTCTGCCTCACGCTGTGCGCCCGGGTGGAGCACCTGACAGACATCAAGCTGGTGTACGTGTGCATCCCGCTCTGGGCCCTCCTCGTCGGGGCCATGGTGGAGCTGGGCTGCAACATCTTCCAGGACCGCAGGGACTAG

Function

GO:

id name namespace
GO:0006259 DNA metabolic process biological_process
GO:0006260 DNA replication biological_process
GO:0006261 DNA-dependent DNA replication biological_process
GO:0006269 DNA replication, synthesis of RNA primer biological_process

KEGG:

id description
ko03030 DNA replication
ko04111 Cell cycle - yeast

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00006519 True 405 mRNA 0.62 1 7651790 7652194

Neighbor

gene id symbol gene type direction distance location
AMCG00006518 NA coding upstream 74517 7541813 ~ 7577273 (+)
AMCG00006517 magi2,magi2a,LOC107694149,LOC107755877 coding upstream 161652 7484144 ~ 7490138 (+)
AMCG00006516 magi2,LOC107554949,LOC107574163,LOC107753655,LOC107661469 coding upstream 361121 7290004 ~ 7290669 (+)
AMCG00006515 gnai1,LOC107386448,LOC108279833,LOC107590838,LOC100706147 coding upstream 416651 7226133 ~ 7235139 (+)
AMCG00006509 NA coding upstream 468687 7149305 ~ 7183103 (+)
AMCG00006521 NA coding downstream 108620 7760814 ~ 7782870 (+)
AMCG00006525 LOC106596391,LOC107735413 coding downstream 155360 7807554 ~ 7812395 (+)
AMCG00006530 NA coding downstream 166478 7818672 ~ 7830030 (+)
AMCG00006528 NA coding downstream 194775 7846969 ~ 7858791 (+)
AMCG00006532 NA coding downstream 220880 7873074 ~ 7877171 (+)
G110243 NA non-coding upstream 18671 7593287 ~ 7633119 (+)
G110245 NA non-coding upstream 318620 7327030 ~ 7333170 (+)
G110240 NA non-coding upstream 411233 7240086 ~ 7240557 (+)
G110201 NA non-coding upstream 508131 7143267 ~ 7143659 (+)
G110167 NA non-coding upstream 714126 6937244 ~ 6937664 (+)
G110286 NA non-coding downstream 42360 7694554 ~ 7695513 (+)
G110361 NA non-coding downstream 261656 7913850 ~ 7914828 (+)
G110429 NA non-coding downstream 435843 8088037 ~ 8090127 (+)
G110439 ahcyl2,LOC102228098,LOC105933830,LOC106941354,LOC103156365 non-coding downstream 480901 8133095 ~ 8135492 (+)
G110444 NA non-coding downstream 521134 8173328 ~ 8175573 (+)
G110163 LOC100846954 other upstream 739536 6911876 ~ 6912254 (+)
AMCG00006501 fam19a5,LOC107552289,LOC106561036,LOC107721159,LOC103356475 other upstream 1063391 6519865 ~ 6588399 (+)
G110023 NA other upstream 1668881 5979062 ~ 5982909 (+)
AMCG00006459 NA other upstream 2517075 5127357 ~ 5134715 (+)
AMCG00006460 wasl,wasla,LOC107698525 other upstream 2544768 5094271 ~ 5107022 (+)
G110279 NA other downstream 1478 7653672 ~ 7655194 (+)
G110445 NA other downstream 523566 8175760 ~ 8176786 (+)
AMCG00006552 NA other downstream 1058556 8710750 ~ 8724066 (+)
AMCG00006565 LOC103366858,LOC103380581 other downstream 1911758 9563952 ~ 9568276 (+)
AMCG00006624 NA other downstream 4493551 12145745 ~ 12323278 (+)

Expression


Co-expression Network