AMCG00006645 (tmem178b,LOC106576670)


Basic Information

Item Value
gene id AMCG00006645
gene name tmem178b,LOC106576670
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030134.1
NCBI id CM030134.1
chromosome length 29342575
location 12938326 ~ 12954435 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00006645
ATGCCCAAGGTAAAGAATAACTTACGGCGGATGACGGCTGGCTTCATGGGCATGGCGGTAGCAATCATTCTGTTTGGCTGGGTCATCGGAGTCCTGGGCTGCTGCTGGGACCGCGGGCTGATGCAGTACGTGGCCGGCCTGCTCTTCCTGATGGGAGCTGGTATCAACTTTGAGCTCTCCCGGTACCCCCGCTATCTCTATGGGCTACCAGATGACATCAGTCATGGCTATGGCTGGTCCATGTTCTGTGCCTGGGGCGGTCTGGGCCTCACCCTCATTGCTGGATTCTTCTGCACACTGGCCCCATCCGTGCAGCCCCTGCCTCGCTCCACCTGCCCCAAATCCAGGCCGGAGAATGGGACCGTCTGTTAA

Function

symbol description
tmem178b Predicted to be integral component of membrane. Predicted to be active in membrane.

NR:

description
PREDICTED: transmembrane protein 178B

GO:

id name namespace
GO:0005923 bicellular tight junction cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0005198 structural molecule activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00006645 True 372 mRNA 0.59 3 12938326 12954435

Neighbor

gene id symbol gene type direction distance location
AMCG00006646 tmem178b,LOC107725619,LOC107694293,LOC107655552,LOC107757211 coding upstream 50090 12883776 ~ 12888236 (+)
AMCG00006640 LOC103371429,LOC103459365,LOC103382520,LOC101068332,LOC100696994 coding upstream 222161 12714480 ~ 12716165 (+)
AMCG00006638 kcna1a,LOC105912431,LOC105913409,LOC108279524,LOC103366871 coding upstream 284906 12651939 ~ 12653420 (+)
AMCG00006639 LOC107562148,LOC107741714,LOC105912408,LOC107687569 coding upstream 319379 12617517 ~ 12618947 (+)
AMCG00006635 NA coding upstream 398318 12530340 ~ 12540008 (+)
AMCG00006650 mkrn1,LOC107757257,LOC107549191,LOC107694290,LOC107725576 coding downstream 61218 13015653 ~ 13035434 (+)
AMCG00006653 NA coding downstream 82238 13036673 ~ 13037830 (+)
AMCG00006659 NA coding downstream 318062 13272497 ~ 13283101 (+)
AMCG00006656 LMO3,lmo3 coding downstream 328719 13283154 ~ 13324717 (+)
AMCG00006655 NA coding downstream 410164 13364599 ~ 13379831 (+)
G111161 NA non-coding upstream 90824 12845923 ~ 12847502 (+)
G111148 NA non-coding upstream 167401 12759571 ~ 12770925 (+)
G111063 NA non-coding upstream 584963 12350757 ~ 12353363 (+)
G111008 crebl2,crbl2 non-coding upstream 913777 12022810 ~ 12024549 (+)
G110930 NA non-coding upstream 1144791 11793168 ~ 11793535 (+)
G111240 NA non-coding downstream 399521 13353956 ~ 13357071 (+)
G111272 hmga2 non-coding downstream 503604 13458039 ~ 13502571 (+)
G111420 NA non-coding downstream 1181884 14136319 ~ 14137744 (+)
G111443 NA non-coding downstream 1357317 14311752 ~ 14312024 (+)
G111531 NA non-coding downstream 1674291 14628726 ~ 14632980 (+)
AMCG00006636 NA other upstream 286511 12620062 ~ 12651815 (+)
AMCG00006624 NA other upstream 615048 12145745 ~ 12323278 (+)
AMCG00006565 LOC103366858,LOC103380581 other upstream 3370050 9563952 ~ 9568276 (+)
AMCG00006552 NA other upstream 4214260 8710750 ~ 8724066 (+)
G110445 NA other upstream 4761540 8175760 ~ 8176786 (+)
G111197 NA other downstream 56749 13011184 ~ 13043448 (+)
AMCG00006672 NA other downstream 979231 13933666 ~ 13939475 (+)
AMCG00006811 NA other downstream 7983062 20937497 ~ 20944977 (+)
G112567 NA other downstream 8093901 21048336 ~ 21049038 (+)
G112600 NA other downstream 8188430 21142865 ~ 21203201 (+)

Expression


Co-expression Network