AMCG00006929 (mtpn,LOC106576424)



Basic Information


Item Value
gene id AMCG00006929
gene name mtpn,LOC106576424
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030134.1
NCBI id CM030134.1
chromosome length 29342575
location 26608543 ~ 26639948 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>AMCG00006929
ATGGGGGACAAGGAACTGATGTGGGCCTTAAAAAATGGAGATCTGGATGTAGTGAAGGATTTTCTTGCTAAGGGGGAGGATGTGAACCGAACTCTTGAAGGTGGAAGGAAGCCACTACACTATGCTGCTGACTGTGGACAATCCGAAATGCTTGAATTCCTTCTTTCCCATGGAGCAGATGTCAATGCCCCAGACAAACACAACATTACTCCCCTCCTCTCAGCCACCTATGAGGGCCACATTGAGTGTGTGAAGATTCTGCTCTCCAAGGGTGCTGACAAGGAAATGAAAGGACCAGATGGACTGAATGCCTTTGAAGCAGCAGAGTGCGCAAATATCAAAGCTTTACTC

Function


symbol description
mtpn Predicted to be involved in regulation of barbed-end actin filament capping. Predicted to be located in perinuclear region of cytoplasm. Predicted to be active in cytoplasm and nucleus. Orthologous to human MTPN (myotrophin).

NR:

description
myotrophin

GO:

id name namespace
GO:0048471 perinuclear region of cytoplasm cellular_component
GO:0005634 nucleus cellular_component

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
AMCG00006929 True 351 mRNA 0.48 4 26608543 26639948

Neighbor


gene id symbol gene type direction distance location
AMCG00006926 NA coding downstream 247092 26192389 ~ 26361451 (-)
AMCG00006924 NA coding downstream 422781 26184251 ~ 26185762 (-)
AMCG00006925 NA coding downstream 467724 26134171 ~ 26140819 (-)
AMCG00006923 NA coding downstream 503157 26092897 ~ 26105386 (-)
AMCG00006922 NA coding downstream 615438 25976490 ~ 25993105 (-)
AMCG00006932 NA coding upstream 668944 27308892 ~ 27309170 (-)
AMCG00006935 NA coding upstream 997272 27637220 ~ 27649919 (-)
AMCG00006934 NA coding upstream 1028838 27668786 ~ 27677200 (-)
AMCG00006938 NA coding upstream 1165535 27805483 ~ 27824074 (-)
AMCG00006939 itfg2 coding upstream 1325019 27964967 ~ 27970379 (-)
G113479 NA non-coding downstream 570220 26001446 ~ 26038323 (-)
G113468 NA non-coding downstream 612614 25995641 ~ 25995929 (-)
G113431 NA non-coding downstream 741264 25866385 ~ 25867279 (-)
G113395 NA non-coding downstream 862558 25741068 ~ 25745985 (-)
G113393 NA non-coding downstream 869676 25738554 ~ 25738867 (-)
G113573 NA non-coding upstream 419421 27059369 ~ 27059594 (-)
G113586 NA non-coding upstream 515587 27155535 ~ 27155857 (-)
G113587 NA non-coding upstream 525231 27165179 ~ 27165398 (-)
G113631 LOC100846954 non-coding upstream 630511 27270459 ~ 27363030 (-)
G113667 NA non-coding upstream 1159990 27799938 ~ 27800294 (-)
G113530 NA other downstream 107862 26500015 ~ 26500681 (-)
AMCG00006866 NA other downstream 3037410 23568155 ~ 23571133 (-)
G113050 NA other downstream 3201336 23404175 ~ 23407207 (-)
AMCG00006854 NA other downstream 3650237 22953176 ~ 22958306 (-)
AMCG00006841 NA other downstream 4410879 22130495 ~ 22197664 (-)
G113645 ptn,LOC106609498 other upstream 762652 27402600 ~ 27527348 (-)
G113775 LOC100846954 other upstream 1627314 28267262 ~ 28292598 (-)
G113833 NA other upstream 2071271 28711219 ~ 28812548 (-)

Expression



Co-expression Network