AMCG00006951 (LOC105898343,LOC106910078,LOC106946326,LOC103151522,LOC107087059)


Basic Information

Item Value
gene id AMCG00006951
gene name LOC105898343,LOC106910078,LOC106946326,LOC103151522,LOC107087059
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030134.1
NCBI id CM030134.1
chromosome length 29342575
location 28493435 ~ 28494011 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00006951
AGCTCCTTATTCCAGCATCTGTAGTGGGAATCATAGTGTTCTTTTATGGCTGTGCAACAATGGATACCAACATACCAAGCCTTGAGATGTGTAGCCACCTGAATAATTTCACCATGTGTCCACTGTGTGATGGGGCATGTGACTACTGGAACCTCAGCACAGCTTGTTCAACTGCTCGTGCCAGCCACCTATTTGACAACCCTGCCACAGTATTCTTCTCTATATTCATGTCCCTCTGG

Function

NR:

description
PREDICTED: anoctamin-2-like

GO:

id name namespace
GO:0016021 integral component of membrane cellular_component

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00006951 True 239 mRNA 0.46 2 28493435 28494011

Neighbor

gene id symbol gene type direction distance location
AMCG00006946 NA coding upstream 92364 28368124 ~ 28401071 (+)
AMCG00006945 NA coding upstream 128825 28332468 ~ 28364610 (+)
AMCG00006947 NA coding upstream 162081 28293020 ~ 28331354 (+)
AMCG00006944 cwf19l1 coding upstream 304608 28147838 ~ 28188827 (+)
AMCG00006943 NA coding upstream 365300 28105608 ~ 28128135 (+)
AMCG00006952 ano2,LOC104963823,LOC103369069 coding downstream 52310 28546321 ~ 28550460 (+)
AMCG00006953 NA coding downstream 132127 28626138 ~ 28626413 (+)
AMCG00006954 rad52,LOC107753587 coding downstream 355772 28849783 ~ 28855154 (+)
AMCG00006961 ninj2 coding downstream 623566 29117577 ~ 29121806 (+)
AMCG00006963 prr5,LOC100286559,LOC101171242 coding downstream 680891 29174902 ~ 29177235 (+)
G113760 NA non-coding upstream 277200 28216000 ~ 28216235 (+)
G113747 NA non-coding upstream 289327 28200542 ~ 28204108 (+)
G113743 klhl42,LOC106576288,LOC106609448 non-coding upstream 351184 28141283 ~ 28142251 (+)
G113741 NA non-coding upstream 354497 28138351 ~ 28138938 (+)
G113717 LOC107575789 non-coding upstream 414976 28077953 ~ 28078459 (+)
G113805 LOC100846954 non-coding downstream 124995 28619006 ~ 28619812 (+)
G113824 NA non-coding downstream 153254 28647265 ~ 28647523 (+)
G113836 NA non-coding downstream 335648 28829659 ~ 28830065 (+)
G113846 NA non-coding downstream 374715 28868726 ~ 28868988 (+)
G113847 NA non-coding downstream 375048 28869059 ~ 28869326 (+)
G113400 NA other upstream 2660493 25815055 ~ 25832942 (+)
G113369 LOC108442871 other upstream 2874990 25618067 ~ 25618445 (+)
AMCG00006893 ndufa9,LOC107572617,LOC107686627,LOC107732787 other upstream 3906316 24509003 ~ 24587119 (+)
AMCG00006884 ccnd2a,ccnd2,LOC106573197,LOC106561356,LOC107575166,LOC107686624,LOC107732799 other upstream 4157519 24304696 ~ 24335916 (+)
AMCG00006878 ndufb2,LOC102790702 other upstream 4457323 24032089 ~ 24036112 (+)

Expression


Co-expression Network