G110245


Basic Information

Item Value
gene id G110245
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030134.1
NCBI id CM030134.1
chromosome length 29342575
location 7327030 ~ 7333170 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU138043
ccacatcactggggagtttgttccagattgtgacgcctctctgtgtgaagaagtgtctcctgttttctgtcttgaatgccttgaagcccaatttccatttgtgtccccgggtccgtgtgtccctgctgatctggaaaagctcctctggtttgatgtggtcgatgcctttcatgattttgaagacttgaatcaagtccccacat

Function

NR:

description
juxtaposed with another zinc finger protein 1-like, partial

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU138043 True 203 lncRNA 0.48 2 7327030 7333170

Neighbor

gene id symbol gene type direction distance location
AMCG00006516 magi2,LOC107554949,LOC107574163,LOC107753655,LOC107661469 coding upstream 36361 7290004 ~ 7290669 (+)
AMCG00006515 gnai1,LOC107386448,LOC108279833,LOC107590838,LOC100706147 coding upstream 91891 7226133 ~ 7235139 (+)
AMCG00006509 NA coding upstream 143927 7149305 ~ 7183103 (+)
AMCG00006508 NA coding upstream 210273 7109344 ~ 7116757 (+)
AMCG00006511 NA coding upstream 268515 7057638 ~ 7058515 (+)
AMCG00006517 magi2,magi2a,LOC107694149,LOC107755877 coding downstream 150974 7484144 ~ 7490138 (+)
AMCG00006518 NA coding downstream 208643 7541813 ~ 7577273 (+)
AMCG00006519 NA coding downstream 318620 7651790 ~ 7652194 (+)
AMCG00006521 NA coding downstream 427644 7760814 ~ 7782870 (+)
AMCG00006525 LOC106596391,LOC107735413 coding downstream 474384 7807554 ~ 7812395 (+)
G110240 NA non-coding upstream 86473 7240086 ~ 7240557 (+)
G110201 NA non-coding upstream 183371 7143267 ~ 7143659 (+)
G110167 NA non-coding upstream 389366 6937244 ~ 6937664 (+)
G110161 NA non-coding upstream 469032 6855880 ~ 6857998 (+)
G110147 NA non-coding upstream 531036 6795749 ~ 6795994 (+)
G110243 NA non-coding downstream 260117 7593287 ~ 7633119 (+)
G110286 NA non-coding downstream 361384 7694554 ~ 7695513 (+)
G110361 NA non-coding downstream 580680 7913850 ~ 7914828 (+)
G110429 NA non-coding downstream 754867 8088037 ~ 8090127 (+)
G110439 ahcyl2,LOC102228098,LOC105933830,LOC106941354,LOC103156365 non-coding downstream 799925 8133095 ~ 8135492 (+)
G110163 LOC100846954 other upstream 414776 6911876 ~ 6912254 (+)
AMCG00006501 fam19a5,LOC107552289,LOC106561036,LOC107721159,LOC103356475 other upstream 738631 6519865 ~ 6588399 (+)
G110023 NA other upstream 1344121 5979062 ~ 5982909 (+)
AMCG00006459 NA other upstream 2192315 5127357 ~ 5134715 (+)
AMCG00006460 wasl,wasla,LOC107698525 other upstream 2220008 5094271 ~ 5107022 (+)
G110279 NA other downstream 320502 7653672 ~ 7655194 (+)
G110445 NA other downstream 842590 8175760 ~ 8176786 (+)
AMCG00006552 NA other downstream 1377580 8710750 ~ 8724066 (+)
AMCG00006565 LOC103366858,LOC103380581 other downstream 2230782 9563952 ~ 9568276 (+)
AMCG00006624 NA other downstream 4812575 12145745 ~ 12323278 (+)

Expression


Co-expression Network