G110439 (ahcyl2,LOC102228098,LOC105933830,LOC106941354,LOC103156365)


Basic Information

Item Value
gene id G110439
gene name ahcyl2,LOC102228098,LOC105933830,LOC106941354,LOC103156365
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030134.1
NCBI id CM030134.1
chromosome length 29342575
location 8133095 ~ 8135492 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU138293
AGCCAATTAGAAATCAAATGGTTGAGAATGTTCCATGAAGGAGCACGGACACTGGTTCCGGAACGGTCAACAGAACGCGGGACGGCACAGACGTTCTCCGCATCGGTTCCACACTAAACAGGGTCAAAGCCGTCGTCCTGGGGGGCACCGCAAACACGGCTCCACCTACCCGTCCAGAATGGACTCCCGGCAGCAGTACAGATTGTCGAACTTCTGTTTGGTGACCGAGTCGTTCACATTCATGGCTGGGACACACAGCTTCCCAGCTTTGGATAACTGGTACAACCTGTGAACTCCAGTGACGCTCTCCTCCACGATTCCCTTGATCTTCTTGAACATGTTGGGGTACTTCTTGTAGATCCAGTGAGTGAGATCTCCTCCGTCATCCAGGATCATGTTAGGCTGCCACCCTTCCACATTGACACAGCGGTCGATACACC

Function

symbol description
ahcyl2 Predicted to enable adenosylhomocysteinase activity. Predicted to be involved in S-adenosylmethionine cycle. Predicted to be located in intracellular membrane-bounded organelle. Predicted to be active in cytosol.

NR:

description
PREDICTED: adenosylhomocysteinase 3 isoform X2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU138293 True 440 lncRNA 0.53 3 8133095 8135492

Neighbor

gene id symbol gene type direction distance location
AMCG00006540 ube2h,LOC105888480,LOC107676921 coding upstream 98263 8026690 ~ 8034832 (+)
AMCG00006539 NA coding upstream 132573 7993931 ~ 8000522 (+)
AMCG00006533 NA coding upstream 152001 7967991 ~ 7981094 (+)
AMCG00006529 smo,LOC106609777,LOC104956154 coding upstream 166561 7955026 ~ 7966534 (+)
AMCG00006531 NA coding upstream 182115 7936383 ~ 7950980 (+)
AMCG00006546 NA coding downstream 87389 8222881 ~ 8244037 (+)
AMCG00006551 NA coding downstream 508750 8644242 ~ 8660293 (+)
AMCG00006558 gpr85,LOC106576049 coding downstream 592151 8727643 ~ 8728326 (+)
AMCG00006556 bmt2 coding downstream 611102 8746594 ~ 8794059 (+)
AMCG00006555 NA coding downstream 664250 8799742 ~ 8807859 (+)
G110429 NA non-coding upstream 42968 8088037 ~ 8090127 (+)
G110361 NA non-coding upstream 218267 7913850 ~ 7914828 (+)
G110286 NA non-coding upstream 437582 7694554 ~ 7695513 (+)
G110243 NA non-coding upstream 499976 7593287 ~ 7633119 (+)
G110245 NA non-coding upstream 799925 7327030 ~ 7333170 (+)
G110444 NA non-coding downstream 37836 8173328 ~ 8175573 (+)
G110446 NA non-coding downstream 43029 8178521 ~ 8178728 (+)
G110447 NA non-coding downstream 43949 8179441 ~ 8179688 (+)
G110523 NA non-coding downstream 659568 8795060 ~ 8795331 (+)
G110558 NA non-coding downstream 752194 8887686 ~ 8888492 (+)
G110279 NA other upstream 477901 7653672 ~ 7655194 (+)
G110163 LOC100846954 other upstream 1220841 6911876 ~ 6912254 (+)
AMCG00006501 fam19a5,LOC107552289,LOC106561036,LOC107721159,LOC103356475 other upstream 1544696 6519865 ~ 6588399 (+)
G110023 NA other upstream 2150186 5979062 ~ 5982909 (+)
AMCG00006459 NA other upstream 2998380 5127357 ~ 5134715 (+)
G110445 NA other downstream 40268 8175760 ~ 8176786 (+)
AMCG00006552 NA other downstream 575258 8710750 ~ 8724066 (+)
AMCG00006565 LOC103366858,LOC103380581 other downstream 1428460 9563952 ~ 9568276 (+)
AMCG00006624 NA other downstream 4010253 12145745 ~ 12323278 (+)
AMCG00006636 NA other downstream 4484570 12620062 ~ 12651815 (+)

Expression


Co-expression Network