G111158


Basic Information

Item Value
gene id G111158
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030134.1
NCBI id CM030134.1
chromosome length 29342575
location 12759571 ~ 12760836 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU139217
CGCCGCTCCCTCCCCGCTTTCGGAAAGGAAGACAAAAGCTTGGATTGCAGGCTGACTTTCAATAGATCGCAGCGAGGGTGGCTGCTCTGCTACGTACAACACCCTGACCCAGAACCAGGTCGTCTGCAAATTATTTAGCACCAGGTTCCCCACGAACATGCGGTGCGTCTCAGGAGAAGGGCAGCCTCTCGTCTGTCTGCTCCCCGGCCCTGACACGAATGGCGCTCTGCACCGGCCCG
>TU139218
CGCCGCTCCCTCCCCGCTTTCGGAAAGGAAGACAAAAGCTTGGATTGCAGGCTGACTTTCAATAGATCGCAGCGAGGGTGGCTGCTCTGCTACGTACAACNCCCTGACCCAGAACCAGGTCGTCTGCAAATTATTTAGCACCAGGTTCCCCACGAACATGCGGTGCGTCTCAGGAGAAGGGCAGCCTCTCGTCTGTCTGCTCCCCGGCCCTGACACGAATGGCGCTCTGCACCGGCCCG

Function

GO:

id name namespace
GO:0002011 morphogenesis of an epithelial sheet biological_process
GO:0055113 epiboly involved in gastrulation with mouth forming second biological_process
GO:0090504 epiboly biological_process
GO:0001702 gastrulation with mouth forming second biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU139217 True 239 lncRNA 0.59 2 12759571 12760836
TU139218 False 239 lncRNA 0.59 2 12759571 12760836

Neighbor

gene id symbol gene type direction distance location
AMCG00006637 arhgap8 coding downstream 198135 12547795 ~ 12561436 (-)
AMCG00006634 nup50,LOC107687567,LOC107601009 coding downstream 314721 12433023 ~ 12444850 (-)
AMCG00006633 NA coding downstream 366870 12386912 ~ 12392701 (-)
AMCG00006628 rtcb coding downstream 378601 12375908 ~ 12380970 (-)
AMCG00006627 rpl18a,LOC106593275 coding downstream 405294 12350767 ~ 12354277 (-)
AMCG00006642 LOC103363517,LOC104927640,LOC108425352 coding upstream 5176 12766012 ~ 12801901 (-)
AMCG00006644 NA coding upstream 88171 12849007 ~ 12851784 (-)
AMCG00006643 braf coding upstream 98341 12859177 ~ 12872555 (-)
AMCG00006647 NA coding upstream 200333 12961169 ~ 12987800 (-)
AMCG00006649 NA coding upstream 229967 12990803 ~ 12991381 (-)
G110957 NA non-coding downstream 857403 11899963 ~ 11902168 (-)
G110942 NA non-coding downstream 963229 11794536 ~ 11796342 (-)
G110940 NA non-coding downstream 966070 11790052 ~ 11793501 (-)
G110939 NA non-coding downstream 970337 11788940 ~ 11789234 (-)
G110917 NA non-coding downstream 1087088 11671569 ~ 11672483 (-)
G111182 NA non-coding upstream 193774 12954610 ~ 12959628 (-)
G111389 NA non-coding upstream 1242917 14003753 ~ 14004141 (-)
G111421 NA non-coding upstream 1375492 14136328 ~ 14137746 (-)
G111448 rap1b,LOC106576640,LOC107695907 non-coding upstream 1407295 14168131 ~ 14214816 (-)
G111451 NA non-coding upstream 1421945 14182781 ~ 14299856 (-)
AMCG00006625 c4h11orf98,c8h11orf98,cunh11orf98,c19h11orf98 other downstream 619166 12137182 ~ 12140405 (-)
AMCG00006622 lrp6 other downstream 629188 12071390 ~ 12130383 (-)
AMCG00006621 borcs5 other downstream 689911 12049494 ~ 12069660 (-)
AMCG00006618 crebl2,LOC102781596 other downstream 735022 12017869 ~ 12024549 (-)
AMCG00006579 yaf2,LOC108439407,LOC105018284,LOC106573089,LOC106561625 other downstream 2652286 10087275 ~ 10107285 (-)
AMCG00006641 mrps33,LOC106591474 other upstream 115456 12876292 ~ 12878656 (-)
AMCG00006663 hmga2 other upstream 694596 13455432 ~ 13503228 (-)
G111489 NA other upstream 1599392 14360228 ~ 14364422 (-)
G111621 NA other upstream 1951181 14712017 ~ 14753970 (-)
G111767 LOC107575789 other upstream 2991985 15752821 ~ 15753235 (-)

Expression


Co-expression Network