G112878 (akr1d1,LOC106917221,LOC103465917,LOC103134490,LOC106953618)


Basic Information

Item Value
gene id G112878
gene name akr1d1,LOC106917221,LOC103465917,LOC103134490,LOC106953618
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030134.1
NCBI id CM030134.1
chromosome length 29342575
location 22669860 ~ 22670883 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU141373
GGATACCTACATCAGCAGCTCCACAAAGCGTATATTTTTGTTAAGCTCCTCAATGGCTTTCATTTCTTCATCGGTAAGGGAGAAGTCAAAGATCTGTAATTTGTCCTTGATGCGCTGAGCACTGAAGCTCTTTGGAATGACCACGACACCCCTCTGAACATTGAAGCGCAAGGACACCTGCGCCGTTGTCTTGTTGTACTTCTTTCCAATCGACACAAGAAGAGCATCTTCTAACAGAGGTGGGCAAGTTAAATTGACCC

Function

symbol description
akr1d1 Predicted to enable 3-oxo-5-beta-steroid 4-dehydrogenase activity; alditol:NADP+ 1-oxidoreductase activity; and ketosteroid monooxygenase activity. Involved in cellular hormone metabolic process; cholesterol catabolic process; and digestion. Acts upstream of or within bile acid biosynthetic process. Located in cytosol. Implicated in congenital bile acid synthesis defect 2.

NR:

description
PREDICTED: 3-oxo-5-beta-steroid 4-dehydrogenase-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU141373 True 260 lncRNA 0.45 2 22669860 22670883

Neighbor

gene id symbol gene type direction distance location
AMCG00006847 NA coding downstream 18343 22626401 ~ 22651517 (-)
AMCG00006846 NA coding downstream 62477 22592099 ~ 22607383 (-)
AMCG00006848 NA coding downstream 80122 22587660 ~ 22589738 (-)
AMCG00006845 NA coding downstream 126457 22534401 ~ 22543403 (-)
AMCG00006840 LOC105913426,LOC108429453 coding downstream 439601 22207663 ~ 22230259 (-)
AMCG00006855 NA coding upstream 210631 22881514 ~ 22928405 (-)
AMCG00006862 si:ch211-125a15.1,LOC107743608,LOC107726025,LOC107580661,LOC107592225,LOC107658829 coding upstream 616373 23287256 ~ 23302174 (-)
AMCG00006864 NA coding upstream 704484 23375367 ~ 23376805 (-)
AMCG00006873 LOC108429457,LOC107745572,LOC107549582,LOC105913374,LOC107669036 coding upstream 960156 23631039 ~ 23752269 (-)
AMCG00006876 LOC108429384,LOC108274557,LOC106584451 coding upstream 1178762 23849645 ~ 23868247 (-)
G112809 NA non-coding downstream 411886 22257549 ~ 22257974 (-)
G112783 NA non-coding downstream 611724 22054622 ~ 22058136 (-)
G112705 NA non-coding downstream 816848 21810365 ~ 21853012 (-)
G112589 NA non-coding downstream 1573552 21095341 ~ 21096308 (-)
G112568 NA non-coding downstream 1637988 21024706 ~ 21031872 (-)
G112903 NA non-coding upstream 95390 22766273 ~ 22772685 (-)
G112953 NA non-coding upstream 270576 22941459 ~ 22941670 (-)
G112979 NA non-coding upstream 482985 23153868 ~ 23154903 (-)
G113013 NA non-coding upstream 650194 23321077 ~ 23321771 (-)
G113014 NA non-coding upstream 652050 23322933 ~ 23323151 (-)
AMCG00006841 NA other downstream 472196 22130495 ~ 22197664 (-)
AMCG00006813 NA other downstream 1705298 20854057 ~ 20964562 (-)
AMCG00006807 NA other downstream 2016201 20647320 ~ 20653659 (-)
G112420 NA other downstream 2433654 20235856 ~ 20236206 (-)
AMCG00006774 meig1,LOC107581293,LOC107744135,LOC107592215 other downstream 3033935 19633093 ~ 19635925 (-)
AMCG00006854 NA other upstream 282293 22953176 ~ 22958306 (-)
G113050 NA other upstream 733292 23404175 ~ 23407207 (-)
AMCG00006866 NA other upstream 897272 23568155 ~ 23571133 (-)
G113530 NA other upstream 3829132 26500015 ~ 26500681 (-)
G113645 ptn,LOC106609498 other upstream 4731717 27402600 ~ 27527348 (-)

Expression


Co-expression Network