G113358


Basic Information

Item Value
gene id G113358
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030134.1
NCBI id CM030134.1
chromosome length 29342575
location 25420658 ~ 25420875 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU141962
CTGCAGGTTCATCTTCTGCAGCTCGTCCTCCCAAGCTGCTCGGTCGTCGTGGTGGTAAGAGATGGGTGGGGCTAAACCTTGGAGAATCTGGGGGTCACGCTCCTGGCAGAGTGCGGTCAGGTGTCCGATGTACAGCTTCAATTTACTGCGGTTCTGGTTGAGATCTAAAAGAGGGGGGATGATCTAAACCAAGGGGGGTGGGGAAGAAGACACTTTAG

Function

NR:

description
PREDICTED: ankyrin repeat and SOCS box protein 12 isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU141962 True 218 lncRNA 0.55 1 25420658 25420875

Neighbor

gene id symbol gene type direction distance location
AMCG00006905 fbxl14b,LOC106590767,LOC107580311,LOC107656333 coding upstream 80600 25336345 ~ 25340058 (+)
AMCG00006903 NA coding upstream 206298 25156086 ~ 25214360 (+)
AMCG00006901 NA coding upstream 306319 25078387 ~ 25114339 (+)
AMCG00006899 NA coding upstream 378700 25040592 ~ 25041958 (+)
AMCG00006898 NA coding upstream 384185 25021130 ~ 25036473 (+)
AMCG00006910 NA coding downstream 294952 25715827 ~ 25721613 (+)
AMCG00006916 NA coding downstream 389688 25810563 ~ 25822470 (+)
AMCG00006912 NA coding downstream 408599 25829474 ~ 25836610 (+)
AMCG00006911 NA coding downstream 430530 25851405 ~ 25861865 (+)
AMCG00006917 LOC107596953 coding downstream 491480 25912355 ~ 25937570 (+)
G113357 NA non-coding upstream 25266 25391855 ~ 25395392 (+)
G113319 NA non-coding upstream 160256 25242565 ~ 25260402 (+)
G113283 NA non-coding upstream 744082 24673625 ~ 24676576 (+)
G113233 NA non-coding upstream 1010354 24410057 ~ 24410304 (+)
G113224 NA non-coding upstream 1047823 24370718 ~ 24372835 (+)
G113372 NA non-coding downstream 267860 25688735 ~ 25689111 (+)
G113373 NA non-coding downstream 276322 25697197 ~ 25697408 (+)
G113383 NA non-coding downstream 302006 25722881 ~ 25724671 (+)
G113394 NA non-coding downstream 320108 25740983 ~ 25745859 (+)
G113409 NA non-coding downstream 471782 25892657 ~ 25894634 (+)
AMCG00006893 ndufa9,LOC107572617,LOC107686627,LOC107732787 other upstream 833539 24509003 ~ 24587119 (+)
AMCG00006884 ccnd2a,ccnd2,LOC106573197,LOC106561356,LOC107575166,LOC107686624,LOC107732799 other upstream 1084742 24304696 ~ 24335916 (+)
AMCG00006878 ndufb2,LOC102790702 other upstream 1384546 24032089 ~ 24036112 (+)
AMCG00006865 hipk2 other upstream 1865917 23509149 ~ 23554741 (+)
AMCG00006829 NA other upstream 3798150 21617632 ~ 21622508 (+)
G113369 LOC108442871 other downstream 197192 25618067 ~ 25618445 (+)
G113400 NA other downstream 394180 25815055 ~ 25832942 (+)

Expression


Co-expression Network