AMCG00007168 (LOC103364365,LOC108229046,LOC101064922)


Basic Information

Item Value
gene id AMCG00007168
gene name LOC103364365,LOC108229046,LOC101064922
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 5858851 ~ 5859267 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00007168
ATGGCTGCCATGAAGATCCTAACGAGCACTGGGCTGTTTCTGGCATTTTGCGCGTTAGGATTGCTAGCGATGGCCATCTGCACGGATAACTGGTACGAGACGGACGCGAGGAGGCACCGGGAAAGGTGCAAGAATTACGCCAACAAGAGGACTGATCCCGGGTACATTTATATCTCCAATCACAACCTCCCCCTCCGCATGCCTCCCAAGGATACTAGTAGCAGGAGAGGGAAGGGAGCGGGCAGCGGGGCTCTGCCCAGAGCCAGGCGGCATTTCCTGGCAGCTGCCTCGGCGATGGAGTCCCACTGCAGCCGCCAGTTCAACTCCACCATCTCCGGGTTGTGGAGGAAGTGTCACCGGGAGGGCTTTGACCTGGAGACCGAAGATCTCATCTATAAAGGTTGGGACCGCATATAG

Function

NR:

description
PREDICTED: transmembrane protein 178B-like

GO:

id name namespace
GO:0005923 bicellular tight junction cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0005198 structural molecule activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00007168 True 417 mRNA 0.57 1 5858851 5859267

Neighbor

gene id symbol gene type direction distance location
AMCG00007167 LOC106587439,LOC106587479,LOC104919254 coding downstream 16984 5826625 ~ 5841867 (-)
AMCG00007163 NA coding downstream 105880 5734674 ~ 5752971 (-)
AMCG00007162 NA coding downstream 165546 5692142 ~ 5693305 (-)
AMCG00007157 kbtbd4,LOC107738697,LOC107686314 coding downstream 181282 5674177 ~ 5677569 (-)
AMCG00007158 celf1,LOC106561939 coding downstream 230479 5613748 ~ 5628372 (-)
AMCG00007170 NA coding upstream 13509 5872776 ~ 5896585 (-)
AMCG00007172 nr1h3,LOC107553099,LOC107689968,LOC107664377 coding upstream 222268 6081535 ~ 6088041 (-)
AMCG00007176 NA coding upstream 262435 6121702 ~ 6122376 (-)
AMCG00007177 NA coding upstream 497743 6357010 ~ 6372398 (-)
AMCG00007185 bbox1,LOC106587091,LOC106561934,LOC107682871 coding upstream 796146 6655413 ~ 6660262 (-)
G21582 NA non-coding downstream 137309 5721263 ~ 5721542 (-)
G21550 NA non-coding downstream 296643 5559594 ~ 5562208 (-)
G21536 NA non-coding downstream 335174 5521615 ~ 5523677 (-)
G21537 prdm11,LOC106560765 non-coding downstream 340100 5517227 ~ 5518751 (-)
G21535 NA non-coding downstream 342880 5514986 ~ 5515971 (-)
G21646 NA non-coding upstream 55805 5915072 ~ 5988322 (-)
G21722 NA non-coding upstream 481512 6340779 ~ 6341171 (-)
G21739 NA non-coding upstream 659856 6519123 ~ 6519736 (-)
G21756 NA non-coding upstream 706950 6566217 ~ 6569739 (-)
G21786 NA non-coding upstream 776316 6635583 ~ 6638309 (-)
G21632 psmc3,prs6a,LOC107758446 other downstream 38567 5816809 ~ 5820284 (-)
G21429 NA other downstream 801445 5056787 ~ 5057406 (-)
G21426 NA other downstream 809331 5041659 ~ 5049520 (-)
AMCG00007091 ckap5,LOC108269026 other downstream 2358181 3476068 ~ 3500670 (-)
AMCG00007072 NA other downstream 3195202 2644905 ~ 2663649 (-)
AMCG00007173 madd other upstream 148373 6007640 ~ 6054064 (-)
AMCG00007201 NA other upstream 1465157 7324424 ~ 7342341 (-)
G21942 NA other upstream 1640180 7499447 ~ 7506875 (-)
G22200 NA other upstream 2533929 8393196 ~ 8396224 (-)
AMCG00007267 NA other upstream 3598221 9457488 ~ 9463337 (-)

Expression


Co-expression Network