AMCG00007337



Basic Information


Item Value
gene id AMCG00007337
gene name NA
gene type misc
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 14478673 ~ 14489692 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>AMCG00007337
ATGGATCCCACTATCGGATACACGCAGAACAAGGCCTATGGACCCGTCACCGTGGTGGAGATTGAGCAGCAGCTTCCTGTGAAAGATCACATCATCTGGTCTATCTTCAACTTCAGCTATCTCAACTGCTGCTGTCTGGGACTGGTGGCTTTTCTTTATTCCATAAAAGCCAGAGACCAGAAAGTCGTCAGGAACCTGAACCAAGCCAAACACTATGGGAGGCTGTCCCGGAATTTCAACATTGCTGCCACCGTTCTCTCCCTGATCGTCATTGCGatcatgctttatttttacagtattcTACTAATCCAAATGATTACAAGCAACATTAATAGGCAGAATACTTATGGCCCTGACTGA
>TU28829
TTATAAAGAGCGCTTTAGTTGCTCGTCTGTAACCACATCGCTTGGCAAGACTGACTGCTTCTTCCGTTGCAGAGAAGTACCAGCCGAGCTATGGATCCCACTATCGGATACACGCAGAACAAGGCCTATGGACCCGTCACCGTGGTGGAGATTGAGCAGCAGCTTCCTGTGAAAGATCACATCATCTGGTCTATCTTCAACTTCAGCTATCTCAACTGCTGCTGTCTGGGACTGGTGGCTTTTCTTTATTCCATAAAAGCCAGAGACCAGAAAGTCGTCAGGAACCTGAACCAAGCCAAACACTATGGGAGGCTGTCCCGGAATTTCAACATTGCTGCCACCGTTCTCTCCCGGAATCTCAACATTGCTGCC

Function


GO: NA

KEGG:

id description
ko04610 Complement and coagulation cascades
ko05150 Staphylococcus aureus infection

RNA


RNA id representative length rna type GC content exon number start site end site
AMCG00007337 False 360 mRNA 0.46 2 14478763 14479838
TU28829 True 372 TUCP 0.50 3 14478673 14489692
Loading

Neighbor


gene id symbol gene type direction distance location
AMCG00007335 cat,LOC102293936 coding upstream 4980 14439326 ~ 14473693 (+)
AMCG00007332 apip coding upstream 94754 14365708 ~ 14383919 (+)
AMCG00007329 slc1a2,LOC107570361 coding upstream 293099 14158184 ~ 14185574 (+)
AMCG00007327 NA coding upstream 414591 14049393 ~ 14064082 (+)
AMCG00007328 NA coding upstream 496820 13975305 ~ 13981853 (+)
AMCG00007336 NA coding downstream 10163 14499855 ~ 14503459 (+)
AMCG00007334 NA coding downstream 28162 14517854 ~ 14522839 (+)
AMCG00007339 NA coding downstream 55203 14544895 ~ 14572261 (+)
AMCG00007338 kcnq1,LOC106562471,LOC104956027,LOC101161541 coding downstream 141070 14630762 ~ 14660061 (+)
AMCG00007341 kcnq1,LOC106562821,LOC105889017,LOC102797067,LOC102292488 coding downstream 171986 14661678 ~ 14893147 (+)
G22979 NA non-coding upstream 188048 14286133 ~ 14290625 (+)
G22962 NA non-coding upstream 263617 14176735 ~ 14215056 (+)
G22944 NA non-coding upstream 413029 14065371 ~ 14065644 (+)
G22940 NA non-coding upstream 413465 14064950 ~ 14065208 (+)
G22935 NA non-coding upstream 437613 14040792 ~ 14041060 (+)
G23100 NA non-coding downstream 534534 15024226 ~ 15024688 (+)
G23130 NA non-coding downstream 727484 15217176 ~ 15309751 (+)
G23154 mob2,LOC108411394 non-coding downstream 1180250 15669942 ~ 15753760 (+)
G23189 NA non-coding downstream 1541072 16030764 ~ 16067082 (+)
G23263 NA non-coding downstream 1662768 16152460 ~ 16157347 (+)
AMCG00007307 clg19h11orf96 other upstream 3865569 10611196 ~ 10613104 (+)
AMCG00007278 NA other upstream 4513406 9936920 ~ 9965267 (+)
G22372 NA other upstream 4978945 9436524 ~ 9499728 (+)
AMCG00007253 calcb,LOC106584617,LOC104951332,LOC107090894,LOC106922915,LOC106950942,LOC103461098 other upstream 5767362 8697983 ~ 8711311 (+)
AMCG00007242 NA other upstream 6027091 8431102 ~ 8451582 (+)
AMCG00007352 NA other downstream 787019 15276711 ~ 15287960 (+)
AMCG00007350 tsg101 other downstream 876969 15366661 ~ 15379965 (+)
AMCG00007379 NA other downstream 2134698 16624390 ~ 16662700 (+)
AMCG00007417 NA other downstream 3708926 18198618 ~ 18201960 (+)
G23698 fem1b other downstream 3717386 18207078 ~ 18208308 (+)

Expression


AMCG00007337 Expression in all Baseline Samples

Bar chart with 16 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2500.
End of interactive chart.

AMCG00007337 Expression in each Bioproject

Bar chart with 7 bars.
AMCG00007337 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 10000.
End of interactive chart.

Co-expression Network