AMCG00007363 (LOC108428835)


Basic Information

Item Value
gene id AMCG00007363
gene name LOC108428835
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 15934147 ~ 15938530 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00007363
ATGGCCGGGGAGAAAGCCCGTCGCCATGTGATGGACACCCAACGCTTGGCCAGCCTCCTGCAGCGGGGTGTGGAGCGCACTCTGGTCATCGACAGCCGCACCTTCTCCGAGTACAACACCTCGCATGTGCTCAGCTCTGTCAACGTCTGCTGTTCAAAGCTGGTGAAGAGGAGGCTGCAGCAGGACAAGGTCTCGGTTACCGAGCTCCTGCAGCCCAACGCCAAGATCAAGGCCCGCCCCCTGTAA

Function

NR:

description
PREDICTED: dual specificity protein phosphatase 8-like isoform X2

GO:

id name namespace
GO:0006470 protein dephosphorylation biological_process
GO:0000188 inactivation of MAPK activity biological_process
GO:0005634 nucleus cellular_component
GO:0005737 cytoplasm cellular_component
GO:0017017 MAP kinase tyrosine/serine/threonine phosphatase activity molecular_function
GO:0004725 protein tyrosine phosphatase activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00007363 True 246 mRNA 0.61 2 15934147 15938530

Neighbor

gene id symbol gene type direction distance location
AMCG00007361 NA coding downstream 43782 15874967 ~ 15890365 (-)
AMCG00007358 mob2,LOC102782240,LOC108411394,LOC106561048 coding downstream 158635 15756293 ~ 15775512 (-)
AMCG00007359 mob2,LOC108411394 coding downstream 177897 15750108 ~ 15756250 (-)
AMCG00007353 LOC107707550,LOC106953705,LOC103466147,LOC101079446,LOC106515651,LOC108239988 coding downstream 549145 15377618 ~ 15385002 (-)
AMCG00007349 NA coding downstream 620714 15288340 ~ 15313433 (-)
AMCG00007362 ptpn5 coding upstream 40783 15979313 ~ 15988623 (-)
AMCG00007364 phlda2,LOC100705395 coding upstream 331437 16269967 ~ 16270377 (-)
AMCG00007374 abtb2b,abtb2,LOC107558307,LOC107675288 coding upstream 446855 16385385 ~ 16444113 (-)
AMCG00007373 b4galnt4 coding upstream 517003 16455533 ~ 16467687 (-)
AMCG00007376 tmem86a,LOC107707555,LOC107675270,LOC107709947,LOC107688565 coding upstream 727021 16665551 ~ 16670635 (-)
G23225 LOC103376870 non-coding downstream 133195 15734625 ~ 15800952 (-)
G23105 NA non-coding downstream 802549 15131388 ~ 15131598 (-)
G23101 LOC101154678 non-coding downstream 909402 15024241 ~ 15024745 (-)
G23011 NA non-coding downstream 1453948 14478596 ~ 14480199 (-)
G22971 NA non-coding downstream 1744459 14184702 ~ 14189688 (-)
G23250 NA non-coding upstream 129553 16068083 ~ 16069464 (-)
G23344 NA non-coding upstream 439988 16378518 ~ 16380291 (-)
G23379 NA non-coding upstream 722351 16660881 ~ 16662665 (-)
G23397 NA non-coding upstream 767759 16706289 ~ 16709180 (-)
G23429 NA non-coding upstream 1009922 16948452 ~ 16948745 (-)
AMCG00007326 pamr1,LOC107570358,LOC107710987,LOC107685072 other downstream 1900935 13981374 ~ 14033212 (-)
G22931 LOC100846954 other downstream 1988082 13945643 ~ 13946065 (-)
G22838 NA other downstream 2582074 13351517 ~ 13352073 (-)
AMCG00007298 NA other downstream 5661452 10265045 ~ 10272695 (-)
AMCG00007289 bet1l,LOC107740886 other downstream 5743943 10187308 ~ 10190204 (-)
AMCG00007366 NA other upstream 298931 16237461 ~ 16314032 (-)
AMCG00007365 cars,LOC107578099,LOC102789774 other upstream 382467 16320997 ~ 16345580 (-)
AMCG00007375 NA other upstream 530937 16469467 ~ 16621905 (-)
G23661 NA other upstream 2116940 18055470 ~ 18058949 (-)
AMCG00007418 fem1b other upstream 2263929 18202459 ~ 18208020 (-)

Expression


Co-expression Network