AMCG00007628


Basic Information

Item Value
gene id AMCG00007628
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 23996928 ~ 23997392 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00007628
ATGGACACCACGGATATCTACGAATTTGATGTCGGTAAAGAAGAGTGGTTTCTTGCCACCACACTGATCAGAGAACAGAGTTATGGCCATTGCATGGTAGCCCACAGAGACAACCTGTATGTGATGAGAAATGGTCCCTCGGATGATTTCTTGAGATGCATGATAGACTGTTATAACACCACTACCGGGCAATGGACGGCTCTGGCAGGGCAGTATGTGAACAGTAAAGGGGCTCTCTTCACGGCCACAGTGAGAGGGGATTCTGTATTCACTGTTAACCGAATGTTGACTCTGGTTTACTCTATAGAAGAGAACAAGTGGAAGCCGAGGAAGGAGATGAAGGGATTCCCAAGGAGTGGCTCAATGCAGACCTTCTTACTGAGGCTGCCAACGAACAGCAGCCAACTGACATGTAAATGTATCCTGAAGGAGAGGGACCACAATGTAGAAAATGTCAATGTTTGA

Function

GO: NA

KEGG:

id description
K21913 KBTBD13; kelch repeat and BTB domain-containing protein 13

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00007628 True 465 mRNA 0.47 1 23996928 23997392

Neighbor

gene id symbol gene type direction distance location
AMCG00007615 spg21,LOC107594761,LOC107685233 coding downstream 30285 23961967 ~ 23966643 (-)
AMCG00007609 pcsk6,LOC107662249,LOC107742302 coding downstream 110261 23845592 ~ 23886667 (-)
AMCG00007610 snrpa1 coding downstream 162290 23831169 ~ 23834638 (-)
AMCG00007608 NA coding downstream 169213 23822491 ~ 23827715 (-)
AMCG00007607 chsy1,LOC106587790,LOC106562599 coding downstream 175453 23819042 ~ 23821475 (-)
AMCG00007623 NA coding upstream 7447 24004839 ~ 24011628 (-)
AMCG00007627 LOC106587701 coding upstream 20073 24017465 ~ 24021945 (-)
AMCG00007626 NA coding upstream 25161 24022553 ~ 24030570 (-)
AMCG00007624 vps33b coding upstream 35161 24032553 ~ 24045372 (-)
AMCG00007625 NA coding upstream 55080 24052472 ~ 24055090 (-)
G25024 NA non-coding downstream 36085 23958476 ~ 23960843 (-)
G25021 NA non-coding downstream 38746 23957980 ~ 23958182 (-)
G25019 NA non-coding downstream 41516 23954421 ~ 23955412 (-)
G25014 NA non-coding downstream 70691 23924239 ~ 23926237 (-)
G24955 NA non-coding downstream 283634 23713039 ~ 23713294 (-)
G25058 NA non-coding upstream 33643 24031035 ~ 24031304 (-)
G25075 NA non-coding upstream 50268 24047660 ~ 24048480 (-)
G25076 mfap1,LOC102796914 non-coding upstream 51832 24049224 ~ 24049437 (-)
G25077 NA non-coding upstream 52161 24049553 ~ 24049784 (-)
G25078 NA non-coding upstream 52423 24049815 ~ 24050073 (-)
G25026 NA other downstream 24263 23971671 ~ 23972665 (-)
AMCG00007594 zfand6,zfand5,zfand5a,LOC105015049 other downstream 576625 23406928 ~ 23420303 (-)
AMCG00007572 LOC107703942,LOC103366351,LOC107665298,LOC107726337 other downstream 1420474 22561496 ~ 22576454 (-)
AMCG00007565 gatm other downstream 1638482 22340599 ~ 22358446 (-)
AMCG00007500 NA other downstream 3524009 20462504 ~ 20472919 (-)
AMCG00007637 NA other upstream 265298 24262690 ~ 24281564 (-)
G25422 NA other upstream 1266940 25264332 ~ 25264951 (-)
AMCG00007684 shf,LOC108430988 other upstream 1633400 25630792 ~ 25631592 (-)
AMCG00007687 LOC107703195,LOC107589318,LOC103130145 other upstream 2056372 26053764 ~ 26070848 (-)
AMCG00007704 NA other upstream 3360339 27357731 ~ 27370519 (-)

Expression


Co-expression Network