AMCG00007633 (LOC106526729,LOC108249217,LOC107091076,LOC102219664)


Basic Information

Item Value
gene id AMCG00007633
gene name LOC106526729,LOC108249217,LOC107091076,LOC102219664
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 24229522 ~ 24230585 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00007633
ATGGAGAGCTCCAGACTGTGGATGAGAGTCGTGGTTTGTGCCGTGTTGCTGTCCGTCGTCTGCGGTGCTGAAACTAACGACTTGGAGGAAAGAGCCTTGACGGACTTCTACCCCAAGGATCCAACCCTGAACAACGAAAAACAGCTGCTTGGCGCTCTACAAGAAGTCCTGGAAAAGCTACAGAGTAAACGGATTCCAGCGTGGGAAAAGAAATTCGGACAAGTTCCCACGTGCGATGTGGGAGAGCAGTGTGCGGTCAGGAAAGGCGCTCGGATCGGCAAGATGTGCGACTGCCCGCGCGGGGCGTTCTGCAACTTTTTCCTGCTGAAGTGCTTGTGA

Function

NR:

description
PREDICTED: cocaine- and amphetamine-regulated transcript protein-like

GO:

id name namespace
GO:0007186 G protein-coupled receptor signaling pathway biological_process
GO:0009267 cellular response to starvation biological_process
GO:0032099 negative regulation of appetite biological_process
GO:0000186 activation of MAPKK activity biological_process
GO:0008343 adult feeding behavior biological_process
GO:0001678 cellular glucose homeostasis biological_process
GO:0005615 extracellular space cellular_component

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00007633 True 339 mRNA 0.54 3 24229522 24230585

Neighbor

gene id symbol gene type direction distance location
AMCG00007622 serinc4 coding upstream 152174 24056196 ~ 24077348 (+)
AMCG00007618 mfap1 coding upstream 177695 24048234 ~ 24051827 (+)
AMCG00007620 hddc3,LOC107757611 coding upstream 185121 24041906 ~ 24044401 (+)
AMCG00007621 NA coding upstream 212909 24013330 ~ 24016613 (+)
AMCG00007619 NA coding upstream 222212 23997437 ~ 24007310 (+)
AMCG00007632 tubgcp4,LOC107695351 coding downstream 25561 24256146 ~ 24261899 (+)
AMCG00007636 map1a,LOC106584644 coding downstream 105976 24336561 ~ 24349947 (+)
AMCG00007638 NA coding downstream 218737 24449322 ~ 24461405 (+)
AMCG00007641 LOC107733946,LOC107685211,LOC108428500,LOC107737001,LOC103353203,LOC107662289 coding downstream 291880 24522465 ~ 24536808 (+)
AMCG00007639 NA coding downstream 342301 24572886 ~ 24574030 (+)
G25138 NA non-coding upstream 612 24228636 ~ 24228910 (+)
G25134 NA non-coding upstream 16078 24211682 ~ 24213444 (+)
G25103 NA non-coding upstream 75674 24150343 ~ 24153848 (+)
G25084 NA non-coding upstream 142218 24085407 ~ 24087304 (+)
G25069 NA non-coding upstream 182913 24044989 ~ 24046609 (+)
G25148 cdkn2aip,LOC107757748,LOC107695352,LOC107730231,LOC107596431,LOC107701282 non-coding downstream 24205 24254790 ~ 24255913 (+)
G25196 NA non-coding downstream 210712 24441297 ~ 24469767 (+)
G25197 LOC105908101 non-coding downstream 240454 24471039 ~ 24473147 (+)
G25203 LOC105015055 non-coding downstream 253701 24484286 ~ 24490748 (+)
G25209 NA non-coding downstream 323683 24554268 ~ 24564852 (+)
AMCG00007631 NA other upstream 35041 24192221 ~ 24194481 (+)
AMCG00007604 asb7,LOC107755647,LOC107662256,LOC107742335,LOC106562481,LOC102792420 other upstream 559443 23657850 ~ 23670079 (+)
G24824 mesdc1,LOC107553753,LOC107691577,LOC107709503,LOC107662264 other upstream 1036001 23189460 ~ 23193521 (+)
AMCG00007585 star5,stard5,LOC104953929 other upstream 1090001 23133811 ~ 23139521 (+)
G24606 NA other upstream 1946564 22281700 ~ 22282958 (+)
AMCG00007640 NA other downstream 245902 24476487 ~ 24499650 (+)
G25822 NA other downstream 3853237 28083822 ~ 28094741 (+)
AMCG00007735 LOC104966693,LOC107388733,LOC105916711,LOC106514397,LOC105007422,LOC106561846 other downstream 4208059 28438644 ~ 28454707 (+)
AMCG00007754 NA other downstream 4451586 28682171 ~ 28700062 (+)
AMCG00007763 tbc1d2b other downstream 4669473 28900058 ~ 28911566 (+)

Expression


Co-expression Network