AMCG00007662 (cib1)


Basic Information

Item Value
gene id AMCG00007662
gene name cib1
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 24799840 ~ 24802378 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00007662
ATGGAAAAGATCCTCACACTACCAGAGCTGAAGTCTAATCCGTTCCGAAAAAGGATTTGTTCTGTGTTCTCTACCTCTGAAGACAAAGATGGCAGCTTGACTTTTGAGGACTTTCTGGACCTTCTGAGTGCCTTCAGCGACTCGGCCACCCCTGAGATCAAATCTCACTATGCCTTCCGCATTTTCGACTTTGATGATGACGGGACCCTGGACCGTGGAGACTTGGAGAAGCTGGTCAACAGCCTGACTGGAGACACCGCAGACACGCGGCTCACCCCCGAGGAAATGAAACAGCTCATCAGCAACATCCTCGAGGAGTCCGATATCGATAAAGACGGGACGGTGAACCTTTCAGAGTTCCAGCATGTCATCTCAAGCTCTTTTAAGATCGTGCTGTGA

Function

symbol description
cib1 Predicted to enable calcium ion binding activity. Is expressed in several structures, including Kupffer's vesicle; axis; pronephric duct; sensory system; and solid lens vesicle. Human ortholog(s) of this gene implicated in epidermodysplasia verruciformis. Orthologous to human CIB1 (calcium and integrin binding 1).

NR:

description
PREDICTED: calcium and integrin-binding protein 1

GO:

id name namespace
GO:0007229 integrin-mediated signaling pathway biological_process
GO:0005509 calcium ion binding molecular_function

KEGG:

id description
K17259 CIB1; calcium and integrin-binding protein 1

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00007662 True 399 mRNA 0.50 5 24799840 24802378

Neighbor

gene id symbol gene type direction distance location
AMCG00007656 man2a2 coding downstream 20223 24761918 ~ 24779617 (-)
AMCG00007651 NA coding downstream 154476 24629506 ~ 24645364 (-)
AMCG00007652 ckmt1,LOC108418758,LOC105913433,LOC106584654,LOC105028550,LOC107661454,LOC107554962,LOC107753597 coding downstream 175367 24614500 ~ 24624473 (-)
AMCG00007646 pdia3,LOC107716732,LOC107753598,LOC107696263,LOC107661453 coding downstream 229543 24563795 ~ 24570297 (-)
AMCG00007642 NA coding downstream 237384 24559055 ~ 24562456 (-)
AMCG00007661 NA coding upstream 3413 24805791 ~ 24810467 (-)
AMCG00007666 NA coding upstream 131930 24934308 ~ 24945796 (-)
AMCG00007668 NA coding upstream 164494 24966872 ~ 24979337 (-)
AMCG00007667 pkm,kpyk coding upstream 187134 24989512 ~ 25006830 (-)
AMCG00007677 NA coding upstream 520710 25323088 ~ 25334806 (-)
G25248 NA non-coding downstream 257682 24498365 ~ 24542158 (-)
G25239 NA non-coding downstream 292021 24433080 ~ 24507819 (-)
G25177 NA non-coding downstream 431467 24368169 ~ 24368373 (-)
G25176 NA non-coding downstream 445530 24350030 ~ 24354310 (-)
G25175 NA non-coding downstream 452421 24347099 ~ 24347419 (-)
G25375 NA non-coding upstream 179556 24981934 ~ 24982139 (-)
G25387 NA non-coding upstream 186467 24988845 ~ 24989054 (-)
G25415 LOC108275329,LOC103046663,LOC108436939,LOC105912564,LOC107696286,LOC103375935,LOC106584709,LOC104942717,LOC107753195 non-coding upstream 405396 25207774 ~ 25247379 (-)
G25421 NA non-coding upstream 450338 25252716 ~ 25256361 (-)
G25446 NA non-coding upstream 649385 25451763 ~ 25452022 (-)
AMCG00007637 NA other downstream 518276 24262690 ~ 24281564 (-)
G25026 NA other downstream 827175 23971671 ~ 23972665 (-)
AMCG00007594 zfand6,zfand5,zfand5a,LOC105015049 other downstream 1379537 23406928 ~ 23420303 (-)
AMCG00007572 LOC107703942,LOC103366351,LOC107665298,LOC107726337 other downstream 2223386 22561496 ~ 22576454 (-)
AMCG00007565 gatm other downstream 2441394 22340599 ~ 22358446 (-)
G25422 NA other upstream 461954 25264332 ~ 25264951 (-)
AMCG00007684 shf,LOC108430988 other upstream 828414 25630792 ~ 25631592 (-)
AMCG00007687 LOC107703195,LOC107589318,LOC103130145 other upstream 1251386 26053764 ~ 26070848 (-)
AMCG00007704 NA other upstream 2555353 27357731 ~ 27370519 (-)
AMCG00007757 tbc1d2b,LOC107757764,LOC107659498 other upstream 4092315 28894693 ~ 28921123 (-)

Expression


Co-expression Network