AMCG00007670 (celf6,LOC104962849,LOC106911022)


Basic Information

Item Value
gene id AMCG00007670
gene name celf6,LOC104962849,LOC106911022
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 25068061 ~ 25076698 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00007670
ATGAACGGGCTGAGCATCGGGCAGAACACCATCCCCATGAAGGACCACGATGCCATCAAGCTCTTCATCGGGCAGATCCCCAGGAACCTGGAGGAGAAAGACCTTAAGCCCCTGTTTGAGGAATTCGGCAAGATCTATGAACTCACCGTGCTGAAAGACAGGTTCACGGGGATGCATAAAGGATGTGCCTTTCTAACATACTGTGCCAGGGAGTCTGCGCTGAAGGCTCAGAGTGCTTTGCACGAGCAGAAGACTCTGCCAGGGGTAAGTGACGTGTTTTCTCTGCTTAACATCTTGCTTCTGGCTATTCTGATCTGA

Function

symbol description
celf6 Predicted to enable mRNA binding activity. Predicted to be involved in mRNA splice site selection and regulation of alternative mRNA splicing, via spliceosome. Predicted to act upstream of or within mRNA processing. Predicted to be part of ribonucleoprotein complex. Predicted to be active in cytoplasm and nucleus. Orthologous to human CELF6 (CUGBP Elav-like family member 6).

NR:

description
PREDICTED: CUGBP Elav-like family member 3-B isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00007670 True 318 mRNA 0.52 2 25068061 25076698

Neighbor

gene id symbol gene type direction distance location
AMCG00007663 parp6,LOC106587213 coding upstream 32373 25015676 ~ 25035688 (+)
AMCG00007664 NA coding upstream 79926 24984997 ~ 24988135 (+)
AMCG00007665 NA coding upstream 84038 24982673 ~ 24984023 (+)
AMCG00007658 NA coding upstream 262573 24804508 ~ 24805488 (+)
AMCG00007659 NA coding upstream 269055 24795449 ~ 24799006 (+)
AMCG00007669 celf6,LOC103138107 coding downstream 64232 25140930 ~ 25170375 (+)
AMCG00007673 NA coding downstream 156192 25232890 ~ 25233495 (+)
AMCG00007672 LOC103046663,LOC107096723,LOC100697142,LOC101479677,LOC102219286 coding downstream 165256 25241954 ~ 25247349 (+)
AMCG00007671 NA coding downstream 171103 25247801 ~ 25256361 (+)
AMCG00007674 LOC107097412,LOC102790211 coding downstream 227581 25304279 ~ 25314909 (+)
G25367 NA non-coding upstream 114733 24953125 ~ 24953328 (+)
G25302 NA non-coding upstream 126481 24934479 ~ 24941580 (+)
G25303 NA non-coding upstream 156690 24879365 ~ 24911371 (+)
G25300 NA non-coding upstream 206193 24817342 ~ 24861868 (+)
G25209 NA non-coding upstream 503209 24554268 ~ 24564852 (+)
G25405 NA non-coding downstream 239089 25315787 ~ 25321025 (+)
G25445 NA non-coding downstream 374835 25451533 ~ 25451793 (+)
G25531 NA non-coding downstream 977003 26053701 ~ 26061246 (+)
G25561 NA non-coding downstream 1057663 26134361 ~ 26134577 (+)
G25562 NA non-coding downstream 1060069 26136767 ~ 26142288 (+)
AMCG00007640 NA other upstream 568411 24476487 ~ 24499650 (+)
AMCG00007631 NA other upstream 873580 24192221 ~ 24194481 (+)
AMCG00007604 asb7,LOC107755647,LOC107662256,LOC107742335,LOC106562481,LOC102792420 other upstream 1397982 23657850 ~ 23670079 (+)
G24824 mesdc1,LOC107553753,LOC107691577,LOC107709503,LOC107662264 other upstream 1874540 23189460 ~ 23193521 (+)
AMCG00007585 star5,stard5,LOC104953929 other upstream 1928540 23133811 ~ 23139521 (+)
G25822 NA other downstream 3007124 28083822 ~ 28094741 (+)
AMCG00007735 LOC104966693,LOC107388733,LOC105916711,LOC106514397,LOC105007422,LOC106561846 other downstream 3361946 28438644 ~ 28454707 (+)
AMCG00007754 NA other downstream 3605473 28682171 ~ 28700062 (+)
AMCG00007763 tbc1d2b other downstream 3823360 28900058 ~ 28911566 (+)
AMCG00007769 acsbg1 other downstream 3926397 29003095 ~ 29006379 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) CI01000165_00657050_00657275 NA coding CI01000165 null 657050 ~ 657673 (-)