AMCG00007684 (shf,LOC108430988)


Basic Information

Item Value
gene id AMCG00007684
gene name shf,LOC108430988
gene type misc
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 25630792 ~ 25631592 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00007684
ATGTCACCAACCAAAGACGGCAAGGCCCGTCCACCACAGCGGCACTCCAGTGGGTGCCTGGTCAGTACCAAGCTGGGCTCCCTGGACCACAGCACATCCCTAGGAGAGCGAATTGACCCCACCCTGCCCCTTGAGAGTCAGTTCTGGTATCACGGCACTATCAGCAGGACGGATGCAGAGAACCTTCTGCGCCTTTGCAAGGAGGCCAGCTACCTGGTCAGAAACAGCGAGACCAGCAAGAATGACTACTCCCTCTCGCTCAAGTAA
>TU31949
attttttataatttcttgtGATATTGCTGAAGATACACGTTTCCAtgaacatgtgttttttttgtacccCCAGTCCAGTTTGACAGTGTTGAGAAGTCACGGATGTCACCAACCAAAGACGGCAAGGCCCGTCCACCACAGCGGCACTCCAGTGGGTGCCTGGTCAGTACCAAGCTGGGCTCCCTGGACCACAGCACATCCCTAGGAGAGCGAATTGACCCCACCCTGCCCCTTGAGAGTCAGTTCTGGTATCACGGCACTATCAGCAGGACGGATGCAGAGAACCTTCTGCGCCTTTGCAAGGAGGCCAGCTACCTGGTCAGAAACAGCGAGACCAGCAAGAATGACTACTCCCTCTCGCTCAAG

Function

symbol description
shf Predicted to enable phosphotyrosine residue binding activity. Predicted to be involved in apoptotic process.

NR:

description
PREDICTED: SH2 domain-containing adapter protein F isoform X4

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00007684 False 267 mRNA 0.58 2 25630792 25631490
TU31949 True 366 TUCP 0.52 2 25630795 25631592

Neighbor

gene id symbol gene type direction distance location
AMCG00007676 LOC106587228 coding downstream 176389 25390189 ~ 25454403 (-)
AMCG00007675 chrna5,LOC106587222,LOC108440259,LOC106562132 coding downstream 250397 25365037 ~ 25380395 (-)
AMCG00007679 NA coding downstream 268395 25359779 ~ 25362397 (-)
AMCG00007678 NA coding downstream 274908 25339362 ~ 25355884 (-)
AMCG00007677 NA coding downstream 295986 25323088 ~ 25334806 (-)
AMCG00007683 LOC107739093,LOC107712505 coding upstream 22128 25653720 ~ 25658719 (-)
AMCG00007689 NA coding upstream 41013 25672605 ~ 25681857 (-)
AMCG00007688 NA coding upstream 231430 25863022 ~ 25895601 (-)
AMCG00007693 NA coding upstream 505060 26136652 ~ 26161514 (-)
AMCG00007694 hmg20a,LOC102798875 coding upstream 631396 26262988 ~ 26272450 (-)
G25446 NA non-coding downstream 178770 25451763 ~ 25452022 (-)
G25421 NA non-coding downstream 374431 25252716 ~ 25256361 (-)
G25415 LOC108275329,LOC103046663,LOC108436939,LOC105912564,LOC107696286,LOC103375935,LOC106584709,LOC104942717,LOC107753195 non-coding downstream 383413 25207774 ~ 25247379 (-)
G25387 NA non-coding downstream 641738 24988845 ~ 24989054 (-)
G25375 NA non-coding downstream 648653 24981934 ~ 24982139 (-)
G25615 NA non-coding upstream 1367714 26999306 ~ 26999546 (-)
G25617 NA non-coding upstream 1397379 27028971 ~ 27029294 (-)
G25620 NA non-coding upstream 1438294 27069886 ~ 27070099 (-)
G25655 NA non-coding upstream 1622637 27254229 ~ 27257033 (-)
G25697 NA non-coding upstream 1722376 27353968 ~ 27355254 (-)
G25422 NA other downstream 365841 25264332 ~ 25264951 (-)
AMCG00007637 NA other downstream 1349228 24262690 ~ 24281564 (-)
G25026 NA other downstream 1658127 23971671 ~ 23972665 (-)
AMCG00007594 zfand6,zfand5,zfand5a,LOC105015049 other downstream 2210489 23406928 ~ 23420303 (-)
AMCG00007572 LOC107703942,LOC103366351,LOC107665298,LOC107726337 other downstream 3054338 22561496 ~ 22576454 (-)
AMCG00007687 LOC107703195,LOC107589318,LOC103130145 other upstream 422172 26053764 ~ 26070848 (-)
AMCG00007704 NA other upstream 1726139 27357731 ~ 27370519 (-)
AMCG00007757 tbc1d2b,LOC107757764,LOC107659498 other upstream 3263101 28894693 ~ 28921123 (-)
AMCG00007768 NA other upstream 3369457 29001049 ~ 29013947 (-)
AMCG00007817 NA other upstream 5560418 31192010 ~ 31246649 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location