AMCG00007715 (csnk1g1,LOC106573333)


Basic Information

Item Value
gene id AMCG00007715
gene name csnk1g1,LOC106573333
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 27612672 ~ 27619156 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00007715
ATGGATCACCCGACCAGGGAAAAGGAGACTGAGCGACCACAGCGGAGCAGCAAGGTGGCCCAAGGGCGCGGCGGCCACTCCCGGCCCTCCAGCTCCAACACGTCCTCGGGGGTCCTTATGGTGGGGCCCAACTTCCGGGTGGGCAAGAAGATAGGCTGCGGCAATTTTGGCGAGCTGAAGCTAGGTAAAAACCTTTACACAAACGAATACGTAGCCATAAAATTGGAACCAATAAAGTCTCGGGCGCCACAGCTGCATTTGGAATACCGATTCTACAAACAGCTGGGAAGCACA

Function

symbol description
csnk1g1 Predicted to enable protein serine/threonine kinase activity. Predicted to be involved in several processes, including Wnt signaling pathway; peptidyl-serine phosphorylation; and positive regulation of canonical Wnt signaling pathway. Predicted to act upstream of or within protein phosphorylation. Predicted to be active in cytoplasm; nucleus; and plasma membrane. Orthologous to human CSNK1G1 (casein kinase 1 gamma 1).

NR:

description
PREDICTED: casein kinase I isoform X4

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00007715 True 294 mRNA 0.56 3 27612672 27619156

Neighbor

gene id symbol gene type direction distance location
AMCG00007717 kiaa0101,paf,LOC106573334 coding upstream 20124 27588670 ~ 27592548 (+)
AMCG00007710 NA coding upstream 46026 27553588 ~ 27566646 (+)
AMCG00007711 NA coding upstream 62709 27533469 ~ 27549963 (+)
AMCG00007709 cpeb1,LOC106587658,LOC105013741 coding upstream 95970 27505666 ~ 27516702 (+)
AMCG00007708 ap3b2 coding upstream 107703 27478011 ~ 27504969 (+)
AMCG00007716 csnk1g1,LOC107738908,LOC107594477,LOC107686826,LOC108271196,LOC103370372,LOC107559435 coding downstream 18061 27637217 ~ 27656565 (+)
AMCG00007714 rps17,rs17,LOC107389132,LOC106527967 coding downstream 43836 27662992 ~ 27667229 (+)
AMCG00007718 NA coding downstream 54606 27673762 ~ 27679214 (+)
AMCG00007723 znf609,LOC796180,LOC107748266,LOC107559441 coding downstream 135057 27754213 ~ 27758823 (+)
AMCG00007721 znf609,LOC107745096,LOC107695009,LOC107680896 coding downstream 176812 27795968 ~ 27813231 (+)
G25753 NA non-coding upstream 41181 27570543 ~ 27571491 (+)
G25709 ppib,LOC102792920,LOC107680152,LOC107577199,LOC107754356,LOC107673286 non-coding upstream 43319 27566695 ~ 27569353 (+)
G25699 NA non-coding upstream 256595 27355874 ~ 27356077 (+)
G25677 slc25a44,s2544,LOC108438536,LOC108432728,LOC107673271 non-coding upstream 282470 27328947 ~ 27330202 (+)
G25674 NA non-coding upstream 305606 27303848 ~ 27307066 (+)
G25819 NA non-coding downstream 451190 28070346 ~ 28078121 (+)
G25827 NA non-coding downstream 485446 28104602 ~ 28109590 (+)
G25984 NA non-coding downstream 1111974 28731130 ~ 28731401 (+)
G26103 frmd5,LOC107691145,LOC107556247,LOC103373640,LOC570903 non-coding downstream 1455300 29074456 ~ 29082381 (+)
G26146 NA non-coding downstream 1692467 29311623 ~ 29311944 (+)
AMCG00007640 NA other upstream 3113022 24476487 ~ 24499650 (+)
AMCG00007631 NA other upstream 3418191 24192221 ~ 24194481 (+)
AMCG00007604 asb7,LOC107755647,LOC107662256,LOC107742335,LOC106562481,LOC102792420 other upstream 3942593 23657850 ~ 23670079 (+)
G24824 mesdc1,LOC107553753,LOC107691577,LOC107709503,LOC107662264 other upstream 4419151 23189460 ~ 23193521 (+)
AMCG00007585 star5,stard5,LOC104953929 other upstream 4473151 23133811 ~ 23139521 (+)
G25822 NA other downstream 464666 28083822 ~ 28094741 (+)
AMCG00007735 LOC104966693,LOC107388733,LOC105916711,LOC106514397,LOC105007422,LOC106561846 other downstream 819488 28438644 ~ 28454707 (+)
AMCG00007754 NA other downstream 1063015 28682171 ~ 28700062 (+)
AMCG00007763 tbc1d2b other downstream 1280902 28900058 ~ 28911566 (+)
AMCG00007769 acsbg1 other downstream 1383939 29003095 ~ 29006379 (+)

Expression


Co-expression Network