AMCG00007771 (frmd5,LOC108435336,LOC107562133)


Basic Information

Item Value
gene id AMCG00007771
gene name frmd5,LOC108435336,LOC107562133
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 29114380 ~ 29122313 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00007771
ATGAATTATGGGTGTGATTTCAATGTTGCTCTTTTCTTCCAGAGGGATGCGAAGGGACAGTACCTGTTTGACCTGATCTGCCACCACCTAAACCTGCTGGAGAAAGACTACTTTGGCATCCGCTATGTGGACCCTGACAAGCAGAGGCATTGGTTGGAGTTCACAAAGTCAATTGCCAAGCAAATGAAATTCGTTGCAGTGGTCATTCTCATCCTCTCTCTGTACTCTACAGCCCAGCCACCATTCACCATGTGTTTTCGGGTCAAGTTCTACCCACCGGACCCTGCTGCTCTGAAAGAAGAAATCACC

Function

symbol description
frmd5 Predicted to be located in cytoskeleton and membrane. Predicted to be integral component of membrane. Orthologous to human FRMD5 (FERM domain containing 5).

NR:

description
PREDICTED: FERM domain-containing protein 5 isoform X3

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00007771 True 309 mRNA 0.48 3 29114380 29122313

Neighbor

gene id symbol gene type direction distance location
AMCG00007770 frmd5,LOC108435336,LOC102299895 coding downstream 13891 29080151 ~ 29100489 (-)
AMCG00007759 cib2,LOC107757746,LOC107598895,LOC107698385,LOC107573330,LOC107752320 coding downstream 154276 28951619 ~ 28960104 (-)
AMCG00007760 dapk2a coding downstream 236363 28866604 ~ 28878017 (-)
AMCG00007761 NA coding downstream 247795 28862578 ~ 28866585 (-)
AMCG00007758 NA coding downstream 270574 28777755 ~ 28843806 (-)
AMCG00007772 NA coding upstream 111446 29233759 ~ 29256619 (-)
AMCG00007779 NA coding upstream 166756 29289069 ~ 29296557 (-)
AMCG00007780 NA coding upstream 253933 29376246 ~ 29377079 (-)
AMCG00007778 NA coding upstream 256731 29379044 ~ 29386305 (-)
AMCG00007783 NA coding upstream 283075 29405388 ~ 29427475 (-)
G26092 NA non-coding downstream 65215 29031410 ~ 29049165 (-)
G25987 NA non-coding downstream 379931 28734112 ~ 28734449 (-)
G25985 NA non-coding downstream 381386 28732764 ~ 28732994 (-)
G25968 NA non-coding downstream 411843 28676840 ~ 28702537 (-)
G26115 NA non-coding upstream 108630 29230943 ~ 29232708 (-)
G26147 NA non-coding upstream 189305 29311618 ~ 29311943 (-)
G26165 NA non-coding upstream 243311 29365624 ~ 29366245 (-)
G26231 NA non-coding upstream 486004 29608317 ~ 29608596 (-)
G26342 NA non-coding upstream 1282685 30404998 ~ 30454628 (-)
AMCG00007768 NA other downstream 100433 29001049 ~ 29013947 (-)
AMCG00007757 tbc1d2b,LOC107757764,LOC107659498 other downstream 193257 28894693 ~ 28921123 (-)
AMCG00007704 NA other downstream 1743861 27357731 ~ 27370519 (-)
AMCG00007687 LOC107703195,LOC107589318,LOC103130145 other downstream 3043532 26053764 ~ 26070848 (-)
AMCG00007684 shf,LOC108430988 other downstream 3482788 25630792 ~ 25631592 (-)
AMCG00007817 NA other upstream 2069697 31192010 ~ 31246649 (-)
AMCG00007822 NA other upstream 2216403 31338716 ~ 31342792 (-)
AMCG00007835 LOC107594750 other upstream 2682586 31804899 ~ 31816151 (-)
G26961 LOC101154678 other upstream 5747122 34869435 ~ 34869807 (-)
AMCG00007883 chrna7,LOC107756517,LOC108274439,LOC106560753,LOC108444230,LOC103033738,LOC107559430,LOC107748270,LOC107679711,LOC107694999 other upstream 6880880 36003193 ~ 36010995 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_034821 frmd5 coding NC_007118.7 CM002891.2 30135768 ~ 30174882 (-)