AMCG00007826


Basic Information

Item Value
gene id AMCG00007826
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 31508671 ~ 31509949 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00007826
TCCCCTGACATCGTCGGCCATAAGCGCAGCGAAAACAAGAACGAAGGGCAGAATGCGCTCATATACTGTAAGTCTGCGGGCTATCCTCATCCAGCCTGGACGTGGCGTAAGGTGAAAGAGAACGTGTTGATGGACATTGACAACTCCTCGGGGCGCTTCTTCATCACCAACAAAGATAATTACTCCGAGCTGATCATCGTGAATCTGGAGATCAACATAGACTCGGGGGAGTATCAGTGTAACGCCACAAACATCATTGGCACTTCATCCATTAAAACCATCCTGCGCGTGCGCAGCCACTTGGCACCTCTGTGGCCCTTCCTGGGCGTGTTGGCAGAGATCATCATCCTGGTGGTCATCATCGTGGTGTACGAGAAACGCAAGAGGCCGGACGAGGTGCCCGAC

Function

GO:

id name namespace
GO:0031399 regulation of protein modification process biological_process
GO:0031400 negative regulation of protein modification process biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00007826 True 405 mRNA 0.53 2 31508671 31509949

Neighbor

gene id symbol gene type direction distance location
AMCG00007825 NA coding upstream 10860 31495939 ~ 31497811 (+)
AMCG00007819 NA coding upstream 169488 31325082 ~ 31339183 (+)
AMCG00007820 NA coding upstream 191275 31305036 ~ 31317396 (+)
AMCG00007818 LOC106573467,LOC106561177 coding upstream 205687 31270675 ~ 31302984 (+)
AMCG00007813 idh2,LOC107714782,LOC107691122,LOC107715227 coding upstream 372424 31111645 ~ 31136247 (+)
AMCG00007833 hcn4,LOC102793391 coding downstream 25380 31535329 ~ 31536009 (+)
AMCG00007832 hcn4,LOC108263998,LOC102197830,LOC105930179 coding downstream 46486 31556435 ~ 31559455 (+)
AMCG00007830 hcn4 coding downstream 70777 31580726 ~ 31618878 (+)
AMCG00007828 NA coding downstream 145048 31654997 ~ 31662592 (+)
AMCG00007829 LOC102800273,LOC107557431 coding downstream 154697 31664646 ~ 31683335 (+)
G26483 NA non-coding upstream 290349 31218110 ~ 31218322 (+)
G26463 NA non-coding upstream 401422 31106714 ~ 31107249 (+)
G26462 NA non-coding upstream 402047 31106414 ~ 31106624 (+)
G26461 NA non-coding upstream 402650 31103954 ~ 31106021 (+)
G26458 NA non-coding upstream 408155 31100271 ~ 31100516 (+)
G26625 NA non-coding downstream 271689 31781638 ~ 31781891 (+)
G26645 NA non-coding downstream 312791 31822740 ~ 31822973 (+)
G26698 NA non-coding downstream 1112311 32622260 ~ 32622530 (+)
G26704 NA non-coding downstream 1377841 32887790 ~ 32888040 (+)
G26826 NA non-coding downstream 2479097 33989046 ~ 33990588 (+)
AMCG00007827 ell3,LOC103370942,LOC102298519,LOC102798071,LOC108431223,LOC107714787 other upstream 68293 31414154 ~ 31440378 (+)
G26258 tpm1,tpma,LOC108237348 other upstream 1689119 29755040 ~ 29819552 (+)
AMCG00007788 NA other upstream 1783937 29622311 ~ 29724734 (+)
AMCG00007769 acsbg1 other upstream 2502292 29003095 ~ 29006379 (+)
AMCG00007763 tbc1d2b other upstream 2597105 28900058 ~ 28911566 (+)
AMCG00007854 NA other downstream 2253564 33763513 ~ 33794941 (+)
AMCG00007873 fam174b,LOC103466638,LOC101474125,LOC102798031,LOC103147863 other downstream 4101033 35610982 ~ 35620801 (+)
AMCG00007889 NA other downstream 4786269 36296218 ~ 36302841 (+)
AMCG00007923 LOC105031092,LOC105901836,LOC102299656,LOC101482251 other downstream 5693921 37203870 ~ 37216558 (+)
G27518 NA other downstream 6635035 38144984 ~ 38146850 (+)

Expression


Co-expression Network