AMCG00007832 (hcn4,LOC108263998,LOC102197830,LOC105930179)


Basic Information

Item Value
gene id AMCG00007832
gene name hcn4,LOC108263998,LOC102197830,LOC105930179
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 31556435 ~ 31559455 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00007832
ATGAGTGTAACATGTCCCCCTTTCTGTAGGTTCTACTGGGATCTGACCATGCTGCTTCTGATGGTGGGCAACTTGATCATTATCCCCGTGGGCATCACCTTCTTCAAGGATGAGCACACGCCCCCCTGGATCGTGTTCAACGTTGTGTCGGACACCTTCTTCCTCATTGACCTGGTGCTCAACTTCCGCACGGGCATCGTCAAGGAGGACAACACCGAGATCATCCTGGACCCGCAGCGCATCAAGATGAAGTACCTGCGCAGCTGGTTCGTGGTGGACTTCATCTCTTCCATCCCTGTGGACTATATCTTCCTCATCGTAGAGACCCGCATCGACTCGGACTTCTACAAGACAGCCCGGGCTCTGCGTATCGTCCGCTTCACCAAGATCCTCAGTCTGCTCAGGCTACTGCGGCTCTCACGCCTCATCCGCTACATCCACCAGTGGGAGGAGAGCACTGCCAACCTCGAATCAAGTGCGGTCTGGTTTTCACAACTCAGAGGCTAG

Function

symbol description
hcn4 Predicted to enable sodium channel activity and voltage-gated potassium channel activity. Acts upstream of or within heart contraction. Predicted to be located in plasma membrane. Predicted to be integral component of membrane. Is expressed in heart primordium and pericardial region. Used to study sick sinus syndrome. Human ortholog(s) of this gene implicated in Brugada syndrome 8; Gilles de la Tourette syndrome; and sick sinus syndrome. Orthologous to human HCN4 (hyperpolarization activated cyclic nucleotide gated potassium channel 4).

NR:

description
PREDICTED: potassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 2-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00007832 True 507 mRNA 0.55 2 31556435 31559455

Neighbor

gene id symbol gene type direction distance location
AMCG00007833 hcn4,LOC102793391 coding upstream 20426 31535329 ~ 31536009 (+)
AMCG00007826 NA coding upstream 46486 31508671 ~ 31509949 (+)
AMCG00007825 NA coding upstream 58624 31495939 ~ 31497811 (+)
AMCG00007819 NA coding upstream 217252 31325082 ~ 31339183 (+)
AMCG00007820 NA coding upstream 239039 31305036 ~ 31317396 (+)
AMCG00007830 hcn4 coding downstream 21271 31580726 ~ 31618878 (+)
AMCG00007828 NA coding downstream 95542 31654997 ~ 31662592 (+)
AMCG00007829 LOC102800273,LOC107557431 coding downstream 105191 31664646 ~ 31683335 (+)
AMCG00007834 det1,LOC107654110,LOC107707445,LOC107701843 coding downstream 235518 31794973 ~ 31800664 (+)
AMCG00007838 NA coding downstream 256788 31816243 ~ 31818992 (+)
G26483 NA non-coding upstream 338113 31218110 ~ 31218322 (+)
G26463 NA non-coding upstream 449186 31106714 ~ 31107249 (+)
G26462 NA non-coding upstream 449811 31106414 ~ 31106624 (+)
G26461 NA non-coding upstream 450414 31103954 ~ 31106021 (+)
G26458 NA non-coding upstream 455919 31100271 ~ 31100516 (+)
G26625 NA non-coding downstream 222183 31781638 ~ 31781891 (+)
G26645 NA non-coding downstream 263285 31822740 ~ 31822973 (+)
G26698 NA non-coding downstream 1062805 32622260 ~ 32622530 (+)
G26704 NA non-coding downstream 1328335 32887790 ~ 32888040 (+)
G26826 NA non-coding downstream 2429591 33989046 ~ 33990588 (+)
AMCG00007827 ell3,LOC103370942,LOC102298519,LOC102798071,LOC108431223,LOC107714787 other upstream 116057 31414154 ~ 31440378 (+)
G26258 tpm1,tpma,LOC108237348 other upstream 1736883 29755040 ~ 29819552 (+)
AMCG00007788 NA other upstream 1831701 29622311 ~ 29724734 (+)
AMCG00007769 acsbg1 other upstream 2550056 29003095 ~ 29006379 (+)
AMCG00007763 tbc1d2b other upstream 2644869 28900058 ~ 28911566 (+)
AMCG00007854 NA other downstream 2204058 33763513 ~ 33794941 (+)
AMCG00007873 fam174b,LOC103466638,LOC101474125,LOC102798031,LOC103147863 other downstream 4051527 35610982 ~ 35620801 (+)
AMCG00007889 NA other downstream 4736763 36296218 ~ 36302841 (+)
AMCG00007923 LOC105031092,LOC105901836,LOC102299656,LOC101482251 other downstream 5644415 37203870 ~ 37216558 (+)
G27518 NA other downstream 6585529 38144984 ~ 38146850 (+)

Expression


Co-expression Network