AMCG00007837 (ntrk3,LOC106573628,LOC107581857,LOC107573919,LOC108269325)


Basic Information

Item Value
gene id AMCG00007837
gene name ntrk3,LOC106573628,LOC107581857,LOC107573919,LOC108269325
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 32392605 ~ 32398918 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00007837
ATGCTCCCAATTCGCTGGATGCCACCAGAAAGCATCATGTACCGTAAATTCACCACAGAAAGTGATGTATGGAGCTTTGGAGTAATTCTCTGGGAGATATTCACCTATGGAAAACAGCCATGGTTTCAGCTAGCCAACAACGAGGTCATTGAGTGCATCACGCAAGGTCGAGTATTGGAGCGGCCCCGTGTTTGTCCTAAGGAAGTATATGACATCATGTTGGGTTGCTGGCAGAGAGAACCCCAGCAACGGCTAAACATCAAGGACATCCAGAAGATCCTTTATGCCTTGGGCAAAGCCACACCTGTCTATCTGGACATCCTGGGCTAG

Function

symbol description
ntrk3 Enables neurotrophin receptor activity and p53 binding activity. Involved in several processes, including activation of GTPase activity; positive regulation of actin cytoskeleton reorganization; and regulation of protein phosphorylation. Part of receptor complex. Implicated in pancreatic cancer. Biomarker of pancreatic ductal carcinoma.

NR:

description
PREDICTED: NT-3 growth factor receptor-like isoform X3

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00007837 True 330 mRNA 0.48 2 32392605 32398918

Neighbor

gene id symbol gene type direction distance location
AMCG00007839 LOC108438531,LOC107714007,LOC108269325,LOC107654144 coding upstream 35959 32325622 ~ 32356646 (+)
AMCG00007840 NA coding upstream 172933 32205006 ~ 32219672 (+)
AMCG00007838 NA coding upstream 573613 31816243 ~ 31818992 (+)
AMCG00007834 det1,LOC107654110,LOC107707445,LOC107701843 coding upstream 591941 31794973 ~ 31800664 (+)
AMCG00007829 LOC102800273,LOC107557431 coding upstream 709270 31664646 ~ 31683335 (+)
AMCG00007841 NA coding downstream 129884 32528802 ~ 32850205 (+)
AMCG00007845 klhl25,LOC106560960,LOC107714043 coding downstream 951176 33350094 ~ 33357685 (+)
AMCG00007846 NA coding downstream 1220385 33619303 ~ 33640336 (+)
AMCG00007847 LOC108243329,LOC107714027,LOC107654092,LOC100696938 coding downstream 1247601 33646519 ~ 33647508 (+)
AMCG00007853 si:dkey-12e7.1,LOC105904526,LOC108427511,LOC103035474,LOC106573761,LOC107583743,LOC107738678 coding downstream 1359785 33758703 ~ 33759842 (+)
G26645 NA non-coding upstream 569632 31822740 ~ 31822973 (+)
G26625 NA non-coding upstream 610714 31781638 ~ 31781891 (+)
G26483 NA non-coding upstream 1174283 31218110 ~ 31218322 (+)
G26463 NA non-coding upstream 1285356 31106714 ~ 31107249 (+)
G26462 NA non-coding upstream 1285981 31106414 ~ 31106624 (+)
G26698 NA non-coding downstream 223342 32622260 ~ 32622530 (+)
G26704 NA non-coding downstream 488872 32887790 ~ 32888040 (+)
G26826 NA non-coding downstream 1590128 33989046 ~ 33990588 (+)
G26825 NA non-coding downstream 1593260 33992178 ~ 33993982 (+)
G26875 NA non-coding downstream 1850278 34249196 ~ 34253554 (+)
AMCG00007827 ell3,LOC103370942,LOC102298519,LOC102798071,LOC108431223,LOC107714787 other upstream 952227 31414154 ~ 31440378 (+)
G26258 tpm1,tpma,LOC108237348 other upstream 2573053 29755040 ~ 29819552 (+)
AMCG00007788 NA other upstream 2667871 29622311 ~ 29724734 (+)
AMCG00007769 acsbg1 other upstream 3386226 29003095 ~ 29006379 (+)
AMCG00007763 tbc1d2b other upstream 3481039 28900058 ~ 28911566 (+)
AMCG00007854 NA other downstream 1364595 33763513 ~ 33794941 (+)
AMCG00007873 fam174b,LOC103466638,LOC101474125,LOC102798031,LOC103147863 other downstream 3212064 35610982 ~ 35620801 (+)
AMCG00007889 NA other downstream 3897300 36296218 ~ 36302841 (+)
AMCG00007923 LOC105031092,LOC105901836,LOC102299656,LOC101482251 other downstream 4804952 37203870 ~ 37216558 (+)
G27518 NA other downstream 5746066 38144984 ~ 38146850 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) CI01000145_00326567_00343828 NTRK3 coding CI01000145 null 325358 ~ 344686 (-)