AMCG00007863 (lrrc28,LOC107706938,LOC107563201,LOC107662304,LOC107690794)


Basic Information

Item Value
gene id AMCG00007863
gene name lrrc28,LOC107706938,LOC107563201,LOC107662304,LOC107690794
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 34044612 ~ 34052190 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00007863
ATGGCCTCCAATTCACTCCATGAAACGATATGCATGGCCAAACAGGAGAAGCACAAGAACCTGTTCCTCAACTACAGGAACCTCAGCAAGTTCCCCGTGGAGCTGCTGATGGACGAGGGCCTGCAGTTCCTGGAGAGACTCTACATGAAGAGGAACTCCTTGACAGCCCTGCCAGAAAATCTAGCCCAGAAGCTACCAAACCTTATTGAACTGTATCTGCGTTCAAACAACATTATCATTGTTCCAGAAGCTATTGGAAATCTGTCCAGGCTTCAGTCTCTGGACCTGAGTGACAACGCCTTGCAGATCATCTGCCCTGAGATTGGGCGCCTGCGGTACCTCCGTCATCTACGACTGGCGAACAATCAGCTGAGGTTCCTCCCCCCA

Function

symbol description
lrrc28 Orthologous to human LRRC28 (leucine rich repeat containing 28).

NR:

description
PREDICTED: leucine-rich repeat-containing protein 28-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00007863 True 387 mRNA 0.51 4 34044612 34052190

Neighbor

gene id symbol gene type direction distance location
AMCG00007860 NA coding upstream 34061 34001037 ~ 34010551 (+)
AMCG00007858 LOC107583745 coding upstream 59832 33940402 ~ 33984780 (+)
AMCG00007857 igf1ra,igf1r,LOC101079603,LOC105904485,LOC106949861 coding upstream 173874 33866963 ~ 33870738 (+)
AMCG00007853 si:dkey-12e7.1,LOC105904526,LOC108427511,LOC103035474,LOC106573761,LOC107583743,LOC107738678 coding upstream 284770 33758703 ~ 33759842 (+)
AMCG00007847 LOC108243329,LOC107714027,LOC107654092,LOC100696938 coding upstream 397104 33646519 ~ 33647508 (+)
AMCG00007864 NA coding downstream 12941 34065131 ~ 34083321 (+)
AMCG00007865 LOC107715609 coding downstream 170709 34222899 ~ 34225641 (+)
AMCG00007866 mef2a coding downstream 188646 34240836 ~ 34249075 (+)
AMCG00007868 NA coding downstream 219573 34271763 ~ 34325416 (+)
AMCG00007867 NA coding downstream 296297 34348487 ~ 34353634 (+)
G26825 NA non-coding upstream 50630 33992178 ~ 33993982 (+)
G26826 NA non-coding upstream 54024 33989046 ~ 33990588 (+)
G26704 NA non-coding upstream 1156572 32887790 ~ 32888040 (+)
G26698 NA non-coding upstream 1422082 32622260 ~ 32622530 (+)
G26645 NA non-coding upstream 2221639 31822740 ~ 31822973 (+)
G26875 NA non-coding downstream 197006 34249196 ~ 34253554 (+)
G26895 NA non-coding downstream 213931 34266121 ~ 34266418 (+)
G26923 NA non-coding downstream 573772 34625962 ~ 34626229 (+)
G26933 NA non-coding downstream 738566 34790756 ~ 34793855 (+)
G26934 NA non-coding downstream 741740 34793930 ~ 34794542 (+)
AMCG00007854 NA other upstream 249671 33763513 ~ 33794941 (+)
AMCG00007827 ell3,LOC103370942,LOC102298519,LOC102798071,LOC108431223,LOC107714787 other upstream 2604234 31414154 ~ 31440378 (+)
G26258 tpm1,tpma,LOC108237348 other upstream 4225060 29755040 ~ 29819552 (+)
AMCG00007788 NA other upstream 4319878 29622311 ~ 29724734 (+)
AMCG00007769 acsbg1 other upstream 5038233 29003095 ~ 29006379 (+)
AMCG00007873 fam174b,LOC103466638,LOC101474125,LOC102798031,LOC103147863 other downstream 1558792 35610982 ~ 35620801 (+)
AMCG00007889 NA other downstream 2244028 36296218 ~ 36302841 (+)
AMCG00007923 LOC105031092,LOC105901836,LOC102299656,LOC101482251 other downstream 3151680 37203870 ~ 37216558 (+)
G27518 NA other downstream 4092794 38144984 ~ 38146850 (+)
AMCG00007952 romo1,LOC102788570 other downstream 4116380 38168570 ~ 38170146 (+)

Expression


Co-expression Network