AMCG00007906 (eif6,if6,LOC107723919)


Basic Information

Item Value
gene id AMCG00007906
gene name eif6,if6,LOC107723919
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 36847554 ~ 36855323 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00007906
ATGGCAGTCCGGGCATCTTTCGAGAACAACAATGAGATCGGCTGCTTCGCCAAGCTCACCAACACTTACTGCCTGGTGGCCATCGGCGGCTCCGAGAACTTCTACAGGCAAGACAGCGTTTCTGTCTTTGAAGGCGAGCTCTCGGAAACCATCCCTGTGGTGCATGCCTCTATAGCAGGCTGTCGGATCATAGGGAGAATGTGTGTAGGGAACCGTCATGGCCTCCTGGTGCCCAATAACACCACAGACCAGGAGCTGCAGCACATCAGAAACTGCCTGCCCGACACTGTGCGTATCCAGCGTGTGGAGGAGCGGCTGTCAGCTCTGGGCAACGTCATCGCTTGCAACGACTACGTGGCACTGGTGCACCCTGACCTGGACCGAGAGACCGAGGAGATCCTGGCCGACAGTCTGAAGGTGGAGGTGTTCCGGCAGACCGTGGCAGAGCAGGTGCTGGTGGGCAGTTACTGCGCCTTCAGCAATCAGGGCGGGCTGGCCGGGACGGTGAACCGTGGCAGCGAGGTGATCGCCGCAGGGATGGTGGTGAACGACTGGTGTGCGTTCTGTGGCCTGGACACCACGAGCACAGAGCTGTCCGTGATCGAGAGCGTGTTCCGGCTGAGCGAGGCCCAGCCCAGCGCCATCGCCACCACCATGAGGGACTCGCTGATCGACAGTGCGGAGGAGCTGTGGGGCGTGGCTGGGGGGCTGCGGGGACCCCACCACTGCGACTCCCCCGCCGCGCAGGAGCGCCCGGCACAGCCATCCATCACGGCCGCGGATGCAGTTGTGATCTATCGGGCCCTGTCTGAGGTCATTGCTGAGCAGAAATAG

Function

symbol description
eif6 Predicted to enable ribosomal large subunit binding activity. Predicted to be involved in assembly of large subunit precursor of preribosome and ribosome biogenesis. Predicted to act upstream of or within mature ribosome assembly and translational initiation. Predicted to be located in cytoplasm and nucleus. Predicted to be part of preribosome, large subunit precursor. Predicted to be active in cytosol and nucleolus. Is expressed in several structures, including alar plate midbrain region; immature eye; nervous system; neural plate; and segmental plate. Orthologous to human EIF6 (eukaryotic translation initiation factor 6).

NR:

description
PREDICTED: eukaryotic translation initiation factor 6

GO:

id name namespace
GO:0006413 translational initiation biological_process
GO:0042256 mature ribosome assembly biological_process
GO:0005730 nucleolus cellular_component
GO:0005737 cytoplasm cellular_component
GO:0043022 ribosome binding molecular_function
GO:0016787 hydrolase activity molecular_function
GO:0003743 translation initiation factor activity molecular_function

KEGG:

id description
K03264 EIF6; translation initiation factor 6

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00007906 True 834 mRNA 0.62 7 36847554 36855323

Neighbor

gene id symbol gene type direction distance location
AMCG00007903 mmp24,LOC107723920,LOC107666082,LOC107587563,LOC107696473 coding upstream 5719 36815650 ~ 36841835 (+)
AMCG00007905 NA coding upstream 55816 36771612 ~ 36791738 (+)
AMCG00007900 tarsl2,LOC106587557 coding upstream 91726 36743984 ~ 36755828 (+)
AMCG00007902 NA coding upstream 129039 36717754 ~ 36718515 (+)
AMCG00007899 LOC106587555,LOC106562349 coding upstream 136167 36700805 ~ 36711387 (+)
AMCG00007904 NA coding downstream 305 36855628 ~ 36865482 (+)
AMCG00007912 NA coding downstream 73730 36929053 ~ 36939598 (+)
AMCG00007909 NA coding downstream 101336 36956659 ~ 36969735 (+)
AMCG00007914 NA coding downstream 168089 37023412 ~ 37034789 (+)
AMCG00007917 NA coding downstream 185159 37040482 ~ 37052197 (+)
G27263 NA non-coding upstream 2030 36843981 ~ 36845524 (+)
G27253 NA non-coding upstream 79615 36767653 ~ 36767939 (+)
G27216 NA non-coding upstream 120437 36685310 ~ 36727117 (+)
G27187 NA non-coding upstream 417623 36429406 ~ 36429931 (+)
G27154 NA non-coding upstream 456734 36329420 ~ 36390820 (+)
G27300 NA non-coding downstream 100859 36956182 ~ 36956454 (+)
G27334 NA non-coding downstream 237326 37092649 ~ 37093330 (+)
G27400 blcap,bc10 non-coding downstream 639836 37495159 ~ 37499385 (+)
G27462 NA non-coding downstream 921742 37777065 ~ 37777462 (+)
G27489 NA non-coding downstream 1161545 38016868 ~ 38017144 (+)
AMCG00007889 NA other upstream 544713 36296218 ~ 36302841 (+)
AMCG00007873 fam174b,LOC103466638,LOC101474125,LOC102798031,LOC103147863 other upstream 1226753 35610982 ~ 35620801 (+)
AMCG00007854 NA other upstream 3052613 33763513 ~ 33794941 (+)
AMCG00007827 ell3,LOC103370942,LOC102298519,LOC102798071,LOC108431223,LOC107714787 other upstream 5407176 31414154 ~ 31440378 (+)
G26258 tpm1,tpma,LOC108237348 other upstream 7028002 29755040 ~ 29819552 (+)
AMCG00007923 LOC105031092,LOC105901836,LOC102299656,LOC101482251 other downstream 348547 37203870 ~ 37216558 (+)
G27518 NA other downstream 1289661 38144984 ~ 38146850 (+)
AMCG00007952 romo1,LOC102788570 other downstream 1313247 38168570 ~ 38170146 (+)
AMCG00007957 raly other downstream 1500606 38355929 ~ 38423155 (+)
G27551 NA other downstream 1576722 38432045 ~ 38436595 (+)

Expression


Co-expression Network