AMCG00007984


Basic Information

Item Value
gene id AMCG00007984
gene name NA
gene type misc
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 38904758 ~ 38907811 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00007984
ATGCACTTTGTCAGCTTCTACGGGAAGCCACTGCAGCACTACATCCGCTACTCTGCGATCTGTGCCCGGGTTGTGCGGGCAGCGCTGAAGCCGCAGCTCAGGGTGGAAGCAGAGAAAGCGACGGAATCCAACGTCAAGGTCTACCGGCCCAAACAGACATGGCTGGTTCTCAGCCTGGTCCTGGACCCCCTCTTCTGGGTCTAG
>TU34636
TAGCAACAGGATGTTGAAGCAGACCGGATATCCGACTTGCCGCTGTCCTTGATccgaggagagggagagagagctgtcTGAAAATGGTGTCCTACTGGAGACAGGCTGGCCTCAGCTACATCCGCTACTCTGCGATCTGTGCCCGGGTTGTGCGGGCAGCGCTGAAGCCGCAGCTCAGGGTGGAAGCAGAGAAAGCGACGGAATCCAACGTCAAGGTCTACCGGCCCAAACAGACATgaCCTGAATGAAAGCAATCCGTGTCGTCCCTGGGAATAAACCCTTCATACCAGCTTTGTCCAGCTGTCCAGTTGGTGATGGGGAAATGGTTTCGACTGTGTACAATAAGACTAGACCAAGATCAAGATGACCCCTCATGCTTCCCTCTGTTTATTTgcttaatgtaataaaaaatatctgaacTT

Function

GO:

id name namespace
GO:0009259 ribonucleotide metabolic process biological_process
GO:0046034 ATP metabolic process biological_process
GO:0006091 generation of precursor metabolites and energy biological_process
GO:1905039 carboxylic acid transmembrane transport biological_process
GO:0042773 ATP synthesis coupled electron transport biological_process
GO:0042775 mitochondrial ATP synthesis coupled electron transport biological_process
GO:0006119 oxidative phosphorylation biological_process
GO:0006122 mitochondrial electron transport, ubiquinol to cytochrome c biological_process
GO:0022900 electron transport chain biological_process
GO:0022904 respiratory electron transport chain biological_process
GO:0006163 purine nucleotide metabolic process biological_process
GO:0017144 drug metabolic process biological_process
GO:0009123 nucleoside monophosphate metabolic process biological_process
GO:0009126 purine nucleoside monophosphate metabolic process biological_process
GO:0009141 nucleoside triphosphate metabolic process biological_process
GO:0009144 purine nucleoside triphosphate metabolic process biological_process
GO:0009150 purine ribonucleotide metabolic process biological_process
GO:0072521 purine-containing compound metabolic process biological_process
GO:1903825 organic acid transmembrane transport biological_process
GO:0009161 ribonucleoside monophosphate metabolic process biological_process
GO:0009167 purine ribonucleoside monophosphate metabolic process biological_process
GO:0015980 energy derivation by oxidation of organic compounds biological_process
GO:0019693 ribose phosphate metabolic process biological_process
GO:0009199 ribonucleoside triphosphate metabolic process biological_process
GO:0009205 purine ribonucleoside triphosphate metabolic process biological_process
GO:0006848 pyruvate transport biological_process
GO:0006850 mitochondrial pyruvate transmembrane transport biological_process
GO:0045333 cellular respiration biological_process
GO:1901475 pyruvate transmembrane transport biological_process
GO:0008137 NADH dehydrogenase (ubiquinone) activity molecular_function
GO:0009055 electron transfer activity molecular_function
GO:0003954 NADH dehydrogenase activity molecular_function
GO:0022857 transmembrane transporter activity molecular_function
GO:0016491 oxidoreductase activity molecular_function
GO:0050136 NADH dehydrogenase (quinone) activity molecular_function
GO:0022890 inorganic cation transmembrane transporter activity molecular_function
GO:0015002 heme-copper terminal oxidase activity molecular_function
GO:0015318 inorganic molecular entity transmembrane transporter activity molecular_function
GO:0005215 transporter activity molecular_function
GO:0015075 ion transmembrane transporter activity molecular_function
GO:0015077 monovalent inorganic cation transmembrane transporter activity molecular_function
GO:0015078 proton transmembrane transporter activity molecular_function
GO:0008324 cation transmembrane transporter activity molecular_function
GO:0003824 catalytic activity molecular_function
GO:0016651 oxidoreductase activity, acting on NAD(P)H molecular_function
GO:0016655 oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor molecular_function
GO:0004129 cytochrome-c oxidase activity molecular_function
GO:0016675 oxidoreductase activity, acting on a heme group of donors molecular_function
GO:0016676 oxidoreductase activity, acting on a heme group of donors, oxygen as acceptor molecular_function

KEGG:

id description
ko00190 Oxidative phosphorylation
ko04260 Cardiac muscle contraction
ko04723 Retrograde endocannabinoid signaling
ko04714 Thermogenesis
ko05010 Alzheimer disease
ko05012 Parkinson disease
ko05016 Huntington disease
ko04932 Non-alcoholic fatty liver disease

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00007984 False 204 mRNA 0.59 3 38904758 38906982
TU34636 True 422 lncRNA 0.51 3 38906153 38907811

Neighbor

gene id symbol gene type direction distance location
AMCG00007977 NA coding downstream 68621 38831105 ~ 38836137 (-)
AMCG00007976 NA coding downstream 87026 38794104 ~ 38817732 (-)
AMCG00007975 nelfcd,LOC107554192,LOC107685805 coding downstream 113973 38785536 ~ 38790785 (-)
AMCG00007972 NA coding downstream 161715 38733689 ~ 38743043 (-)
AMCG00007973 ppp4r1 coding downstream 211984 38679465 ~ 38692774 (-)
AMCG00007982 slc32a1,LOC108436412,LOC108272428 coding upstream 35024 38942835 ~ 38949522 (-)
AMCG00007988 NA coding upstream 69104 38976915 ~ 38985485 (-)
AMCG00007989 map1lc3a,LOC101077757,LOC102789823,LOC107685654 coding upstream 162769 39070580 ~ 39078098 (-)
AMCG00007992 LOC108424671,LOC107566077,LOC107691346 coding upstream 205900 39113711 ~ 39150259 (-)
AMCG00007994 NA coding upstream 264677 39172488 ~ 39204907 (-)
G27668 NA non-coding downstream 48981 38855548 ~ 38855777 (-)
G27661 NA non-coding downstream 125006 38776161 ~ 38779752 (-)
G27639 NA non-coding downstream 137190 38749127 ~ 38767568 (-)
G27626 NA non-coding downstream 192421 38710852 ~ 38712337 (-)
G27557 NA non-coding downstream 464896 38439603 ~ 38439862 (-)
G27686 NA non-coding upstream 13159 38920970 ~ 38922688 (-)
G27833 NA non-coding upstream 547229 39455040 ~ 39455858 (-)
G27904 NA non-coding upstream 856119 39763930 ~ 39764417 (-)
G27927 NA non-coding upstream 882735 39790546 ~ 39791484 (-)
G27949 NA non-coding upstream 934520 39842331 ~ 39847044 (-)
G27522 NA other downstream 740216 38161286 ~ 38164542 (-)
G27502 NA other downstream 812880 38085929 ~ 38091878 (-)
G27442 chd6 other downstream 1316233 37573034 ~ 37588525 (-)
G27439 NA other downstream 1333270 37570957 ~ 37571488 (-)
G27437 NA other downstream 1335474 37567617 ~ 37569284 (-)
AMCG00007983 NA other upstream 16770 38924581 ~ 38937663 (-)
AMCG00007990 ppp1r16b,LOC106566117,LOC107558141 other upstream 124976 39032787 ~ 39049597 (-)
G27720 NA other upstream 146342 39054153 ~ 39055679 (-)
AMCG00007993 dynlrb1,LOC106565026 other upstream 180746 39088557 ~ 39091895 (-)
G27861 LOC797048,LOC108410937,LOC107740256,LOC105897858 other upstream 592510 39500321 ~ 39504592 (-)

Expression


Co-expression Network