AMCG00008180 (bmp7b,bmp7,LOC105030895,LOC107601355,LOC106571911,LOC107750885,LOC106566746)


Basic Information

Item Value
gene id AMCG00008180
gene name bmp7b,bmp7,LOC105030895,LOC107601355,LOC106571911,LOC107750885,LOC106566746
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 44997485 ~ 44997916 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00008180
ATGGTTTCCTTACTGGACAAAGCTGCCCCAGCCCTGGTTCTGCTGTGGGGATACTGCGCTCTGGCTGACACCGTGTTCAGCAACTTCACTCTGGACAACGAGGTGCACTCGAGCTTCATCCACCGGCGCTTGAAGAGCCAGGAGCGCCGGGAGATGCAGCGGGAGATCCTGTCCATACTGGGGCTGCCCCACCGGCCCCGGCCGCACCTCCACGGCAAGCACAACGCGGCGCCCATGTTCATGCTGGACCTGTACAATGCCATGTCCACCGAGGGGGACGAGGAGGGCTACTCGTACCCCTACAAGCCCGTCTTCACCACGCAGGGACCCCCGATTGCCACCCTGCAGGACAACAACTTCCTCAACGATGCTGACATGGTCATGAGCTTTGTAAACCTGGGTAGGTTCCTCCAGTGCGCTATTGTCTTTTAA

Function

symbol description
bmp7b Predicted to enable BMP receptor binding activity and cytokine activity. Predicted to be involved in BMP signaling pathway; SMAD protein signal transduction; and positive regulation of pathway-restricted SMAD protein phosphorylation. Predicted to be located in extracellular region. Predicted to be active in extracellular space. Is expressed in several structures, including digestive system; fin; neuroepithelial cell; optic cup; and sensory system. Human ortholog(s) of this gene implicated in prostate cancer. Orthologous to human BMP7 (bone morphogenetic protein 7).
bmp7 Predicted to enable BMP receptor binding activity and cytokine activity. Involved in several processes, including regulation of gene expression; regulation of protein phosphorylation; and transmembrane receptor protein serine/threonine kinase signaling pathway. Acts upstream of or within negative regulation of neuron differentiation and neuron projection morphogenesis. Located in extracellular space. Implicated in prostate cancer. Biomarker of breast cancer; ovarian carcinoma; prostate cancer; and renal cell carcinoma.

NR:

description
PREDICTED: bone morphogenetic protein 7

GO:

id name namespace
GO:0040007 growth biological_process
GO:0005576 extracellular region cellular_component
GO:0008083 growth factor activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00008180 True 432 mRNA 0.60 1 44997485 44997916

Neighbor

gene id symbol gene type direction distance location
AMCG00008176 LOC103370837,LOC107750885 coding downstream 13740 44971340 ~ 44983745 (-)
AMCG00008175 NA coding downstream 34308 44951398 ~ 44963177 (-)
AMCG00008172 NA coding downstream 114273 44879010 ~ 44883212 (-)
AMCG00008173 NA coding downstream 125270 44852289 ~ 44872215 (-)
AMCG00008174 NA coding downstream 183405 44795926 ~ 44814080 (-)
AMCG00008183 NA coding upstream 64865 45062781 ~ 45070971 (-)
AMCG00008182 cstf1 coding upstream 89281 45087197 ~ 45092120 (-)
AMCG00008184 NA coding upstream 94868 45092784 ~ 45095951 (-)
AMCG00008191 NA coding upstream 235473 45233389 ~ 45234479 (-)
AMCG00008190 NA coding upstream 237143 45235059 ~ 45239415 (-)
G28976 NA non-coding downstream 309310 44682437 ~ 44688175 (-)
G28978 NA non-coding downstream 315716 44681425 ~ 44681769 (-)
G28977 cdh4,LOC101161393 non-coding downstream 317443 44679816 ~ 44680042 (-)
G28974 LOC101069589,LOC106525190,LOC104949831 non-coding downstream 330908 44666343 ~ 44666577 (-)
G28973 NA non-coding downstream 510066 44487210 ~ 44487419 (-)
G29081 NA non-coding upstream 36529 45034445 ~ 45036413 (-)
G29170 NA non-coding upstream 355891 45353807 ~ 45354086 (-)
G29182 NA non-coding upstream 421674 45419590 ~ 45420462 (-)
G29192 NA non-coding upstream 463863 45461779 ~ 45462530 (-)
G29206 NA non-coding upstream 492091 45490007 ~ 45490890 (-)
G28970 NA other downstream 579289 44417874 ~ 44418196 (-)
AMCG00008144 phf20,LOC107727854 other downstream 1414072 43510760 ~ 43583413 (-)
AMCG00008124 LOC105922603,LOC105919618,LOC103147358,LOC106964922,LOC102223196,LOC103465560,LOC107100266,LOC108244412 other downstream 1877321 43097111 ~ 43120164 (-)
G28581 mafba,mafb,LOC107562627,LOC107713570,LOC106535696 other downstream 2232831 42761004 ~ 42764654 (-)
AMCG00008104 samd10 other downstream 2596411 42359900 ~ 42401074 (-)
AMCG00008192 NA other upstream 151585 45149501 ~ 45228504 (-)
G29301 NA other upstream 1052779 46050695 ~ 46054346 (-)
G29361 NA other upstream 1483030 46480946 ~ 46481898 (-)
AMCG00008233 NA other upstream 2582223 47580139 ~ 47607012 (-)
AMCG00008245 si:ch211-199o1.2,LOC105896344,LOC105896343,LOC108441608,LOC107668030,LOC108418094,LOC101067989 other upstream 2668726 47666642 ~ 47918462 (-)

Expression


Co-expression Network