AMCG00008225 (ctnnbl1)


Basic Information

Item Value
gene id AMCG00008225
gene name ctnnbl1
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 46235003 ~ 46238529 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00008225
ATGGGCAAGGACTCCGCCAGACTCCCTGATGTGGATGACCTGGACAACGATGATGTGGTCACGGACAAGAAGAAAGTCCTGGAGAAACTCATGGAGAATGAGGAGGATCAAGAGGCAGAACCTGTGGATGAGAGCTCCGTGAAGAAGATGATTCTGACATTTGAAAAAAGATCCTACAAAAACCAAGAACTACGTATTAAGTTCCCTGACAATCCTGAGAAGTTCATGGAAGCAGAACTGGACCTGAATGATATCATCCAGGAGATGCATGTAATTGCCACCATGCCTGACCTCTATCACTTACTGGTGGAGCTGAACGCTGTCCATTCCTTGCTTGGCTTGCTGAGCCATGAAAACACTGATATCCTTTCTATCATTTTACAACCTCTGTCATAG

Function

symbol description
ctnnbl1 Predicted to be located in nucleus. Predicted to be part of spliceosomal complex. Human ortholog(s) of this gene implicated in colorectal cancer and morbid obesity. Orthologous to human CTNNBL1 (catenin beta like 1).

NR:

description
beta-catenin-like protein 1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00008225 True 396 mRNA 0.46 3 46235003 46238529

Neighbor

gene id symbol gene type direction distance location
AMCG00008224 ctnnbl1,LOC106566902 coding downstream 16 46200792 ~ 46234987 (-)
AMCG00008223 NA coding downstream 84840 46137748 ~ 46150163 (-)
AMCG00008222 NA coding downstream 111236 46111936 ~ 46123767 (-)
AMCG00008216 NA coding downstream 448022 45777462 ~ 45786981 (-)
AMCG00008214 NA coding downstream 474221 45737488 ~ 45760782 (-)
AMCG00008228 NA coding upstream 508664 46747193 ~ 46747558 (-)
AMCG00008229 cdh22,LOC106565306,LOC107553911 coding upstream 719336 46957865 ~ 46964572 (-)
AMCG00008230 cdh22 coding upstream 742807 46981336 ~ 47013277 (-)
AMCG00008227 cdh22,LOC107681302,LOC107666158 coding upstream 808193 47046722 ~ 47068199 (-)
AMCG00008231 LOC107681302,LOC107587604 coding upstream 853762 47092291 ~ 47117500 (-)
G29294 NA non-coding downstream 255535 45979260 ~ 45979468 (-)
G29284 NA non-coding downstream 441052 45793678 ~ 45793951 (-)
G29249 NA non-coding downstream 520966 45599559 ~ 45714037 (-)
G29206 NA non-coding downstream 744113 45490007 ~ 45490890 (-)
G29192 NA non-coding downstream 772473 45461779 ~ 45462530 (-)
G29348 NA non-coding upstream 12134 46250663 ~ 46251181 (-)
G29354 NA non-coding upstream 29364 46267893 ~ 46268278 (-)
G29375 NA non-coding upstream 417705 46656234 ~ 46656566 (-)
G29377 NA non-coding upstream 485104 46723633 ~ 46723895 (-)
G29381 NA non-coding upstream 665263 46903792 ~ 46904222 (-)
G29301 NA other downstream 180657 46050695 ~ 46054346 (-)
AMCG00008192 NA other downstream 1006499 45149501 ~ 45228504 (-)
G28970 NA other downstream 1816807 44417874 ~ 44418196 (-)
AMCG00008144 phf20,LOC107727854 other downstream 2651590 43510760 ~ 43583413 (-)
AMCG00008124 LOC105922603,LOC105919618,LOC103147358,LOC106964922,LOC102223196,LOC103465560,LOC107100266,LOC108244412 other downstream 3114839 43097111 ~ 43120164 (-)
G29361 NA other upstream 242417 46480946 ~ 46481898 (-)
AMCG00008233 NA other upstream 1341610 47580139 ~ 47607012 (-)
AMCG00008245 si:ch211-199o1.2,LOC105896344,LOC105896343,LOC108441608,LOC107668030,LOC108418094,LOC101067989 other upstream 1428113 47666642 ~ 47918462 (-)
G29544 LOC100846954 other upstream 1885396 48123925 ~ 48124682 (-)
AMCG00008256 arfgef2 other upstream 1964092 48202621 ~ 48291443 (-)

Expression


Co-expression Network