AMCG00008229 (cdh22,LOC106565306,LOC107553911)


Basic Information

Item Value
gene id AMCG00008229
gene name cdh22,LOC106565306,LOC107553911
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 46957865 ~ 46964572 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00008229
ATGGGCGGGAGGAGGGTTCTCGTGCTTCTCATCTTGACGCTGAAGCGCCACCGCAAGGGCCAGCGCATGTCCGAGGATGAGGAGGACATGAGAGACAATGTGATCAAGTACAACGACGAGGGCGGGGGCGAGCAAGACACGCAGGCCTACGACATGAGTGCCCTGCGCAGCCTGTACGACTTCCCCGAGGTGAAGGGCGCCGACTCGGGGCCAGACCTGCACTCGCTGCCCCAGTGGGTCCAGAGCCACGTGGGTGGGGGGGACGGCCTGGCAGACTTCTCCATGTTCCGAGGCTACATCCGCAAGAAGGTGGAGCAGGCCGACGCTGATCTCTCGGTGCCCCCCTACGACTCCTTCCAGACCTATGCCTTTGAGGGTTCCAGCTCTCCGGCATTGTCCCTCAGCTCTATCAACACCCTCTCCACCACCTCCGAGCAGGACTTCTCCTACCTGTCCAACTGGGGACCACGCTTCCGCCAACTGGCCAGCCTCTATGCAGCAGGGCACCCCGAGGAGGAAGGTTCCTAG

Function

symbol description
cdh22 Predicted to enable calcium ion binding activity. Predicted to act upstream of or within homophilic cell adhesion via plasma membrane adhesion molecules. Predicted to be located in plasma membrane. Predicted to be integral component of membrane.

NR:

description
PREDICTED: cadherin-22-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00008229 True 528 mRNA 0.63 2 46957865 46964572

Neighbor

gene id symbol gene type direction distance location
AMCG00008228 NA coding downstream 210307 46747193 ~ 46747558 (-)
AMCG00008225 ctnnbl1 coding downstream 719336 46235003 ~ 46238529 (-)
AMCG00008224 ctnnbl1,LOC106566902 coding downstream 722878 46200792 ~ 46234987 (-)
AMCG00008223 NA coding downstream 807702 46137748 ~ 46150163 (-)
AMCG00008222 NA coding downstream 834098 46111936 ~ 46123767 (-)
AMCG00008230 cdh22 coding upstream 16764 46981336 ~ 47013277 (-)
AMCG00008227 cdh22,LOC107681302,LOC107666158 coding upstream 82150 47046722 ~ 47068199 (-)
AMCG00008231 LOC107681302,LOC107587604 coding upstream 127719 47092291 ~ 47117500 (-)
AMCG00008234 ddx27,LOC107553908,LOC107681294,LOC107587605,LOC107744345 coding upstream 651281 47615853 ~ 47619787 (-)
AMCG00008235 snrpb,LOC108272150,LOC108250717 coding upstream 667758 47632330 ~ 47639937 (-)
G29383 NA non-coding downstream 23597 46931359 ~ 46934268 (-)
G29381 NA non-coding downstream 53643 46903792 ~ 46904222 (-)
G29377 NA non-coding downstream 233970 46723633 ~ 46723895 (-)
G29375 NA non-coding downstream 301299 46656234 ~ 46656566 (-)
G29354 NA non-coding downstream 689587 46267893 ~ 46268278 (-)
G29397 NA non-coding upstream 154065 47118637 ~ 47121378 (-)
G29403 NA non-coding upstream 445215 47409787 ~ 47410050 (-)
G29410 NA non-coding upstream 565860 47530432 ~ 47530659 (-)
G29521 NA non-coding upstream 1044085 48008657 ~ 48012955 (-)
G29530 NA non-coding upstream 1063145 48027717 ~ 48030913 (-)
G29361 NA other downstream 475967 46480946 ~ 46481898 (-)
G29301 NA other downstream 903519 46050695 ~ 46054346 (-)
AMCG00008192 NA other downstream 1729361 45149501 ~ 45228504 (-)
G28970 NA other downstream 2539669 44417874 ~ 44418196 (-)
AMCG00008144 phf20,LOC107727854 other downstream 3374452 43510760 ~ 43583413 (-)
AMCG00008233 NA other upstream 615567 47580139 ~ 47607012 (-)
AMCG00008245 si:ch211-199o1.2,LOC105896344,LOC105896343,LOC108441608,LOC107668030,LOC108418094,LOC101067989 other upstream 702070 47666642 ~ 47918462 (-)
G29544 LOC100846954 other upstream 1159353 48123925 ~ 48124682 (-)
AMCG00008256 arfgef2 other upstream 1238049 48202621 ~ 48291443 (-)
AMCG00008255 NA other upstream 1446513 48411085 ~ 48418933 (-)

Expression


Co-expression Network