AMCG00008230 (cdh22)


Basic Information

Item Value
gene id AMCG00008230
gene name cdh22
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 46981336 ~ 47013277 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00008230
ATGATGAGAGTCTTCTTACATCACTGCAAGACCAGGTACTCCGCATTCGCACTCTCTTCTGTCATTGCAGATAACCCAGCCCAGGCCACCAAGACCTCCATCAGCATCCGCATCCTAGACGTGAACGATAACCCCCCTGAGCTGGCCACTCCTTACGAAGCCTCCATCTGTGAGGACGCCAAGCCTGGTCAGCTCATTCACACCATCAGCGTGGTGGATCGAGATGAGCCACAAACTGGACATCGCTTCTACTTCACCTTGGCCCCAGAGGCTGCCAACAACCGCCACTTCACCCTTTGGGATGTCAAAGACAACACGGCAGGCATCAGGACACAGCGCACTGGCTTCAACAGGCGGGAGCAGAACGTGTACCTGCTGCCCATCCTGGTGGTGGACAGCGGGCCGCCCGCCCTGAGCAGCACCGGCACTCTGACCATCCGCGTGTGCGGCTGCGACACCGAGGGCACCATCCAGTCCTGCAACGCCACCGCATACGTCATGTCAGCCGCCCTCAGCCCCGGGGCACTCATCGCACTGCTAGTCTGTATGCTCATCCTCATTGGCCAGGGATGA

Function

symbol description
cdh22 Predicted to enable calcium ion binding activity. Predicted to act upstream of or within homophilic cell adhesion via plasma membrane adhesion molecules. Predicted to be located in plasma membrane. Predicted to be integral component of membrane.

NR:

description
PREDICTED: cadherin-22

GO:

id name namespace
GO:0007156 homophilic cell adhesion via plasma membrane adhesion molecules biological_process
GO:0005886 plasma membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0005509 calcium ion binding molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00008230 True 573 mRNA 0.59 4 46981336 47013277

Neighbor

gene id symbol gene type direction distance location
AMCG00008229 cdh22,LOC106565306,LOC107553911 coding downstream 16764 46957865 ~ 46964572 (-)
AMCG00008228 NA coding downstream 233778 46747193 ~ 46747558 (-)
AMCG00008225 ctnnbl1 coding downstream 742807 46235003 ~ 46238529 (-)
AMCG00008224 ctnnbl1,LOC106566902 coding downstream 746349 46200792 ~ 46234987 (-)
AMCG00008223 NA coding downstream 831173 46137748 ~ 46150163 (-)
AMCG00008227 cdh22,LOC107681302,LOC107666158 coding upstream 33445 47046722 ~ 47068199 (-)
AMCG00008231 LOC107681302,LOC107587604 coding upstream 79014 47092291 ~ 47117500 (-)
AMCG00008234 ddx27,LOC107553908,LOC107681294,LOC107587605,LOC107744345 coding upstream 602576 47615853 ~ 47619787 (-)
AMCG00008235 snrpb,LOC108272150,LOC108250717 coding upstream 619053 47632330 ~ 47639937 (-)
AMCG00008236 elmo2,LOC106583331,LOC106565399 coding upstream 629702 47642979 ~ 47676750 (-)
G29383 NA non-coding downstream 47068 46931359 ~ 46934268 (-)
G29381 NA non-coding downstream 77114 46903792 ~ 46904222 (-)
G29377 NA non-coding downstream 257441 46723633 ~ 46723895 (-)
G29375 NA non-coding downstream 324770 46656234 ~ 46656566 (-)
G29354 NA non-coding downstream 713058 46267893 ~ 46268278 (-)
G29397 NA non-coding upstream 105360 47118637 ~ 47121378 (-)
G29403 NA non-coding upstream 396510 47409787 ~ 47410050 (-)
G29410 NA non-coding upstream 517155 47530432 ~ 47530659 (-)
G29521 NA non-coding upstream 995380 48008657 ~ 48012955 (-)
G29530 NA non-coding upstream 1014440 48027717 ~ 48030913 (-)
G29361 NA other downstream 499438 46480946 ~ 46481898 (-)
G29301 NA other downstream 926990 46050695 ~ 46054346 (-)
AMCG00008192 NA other downstream 1752832 45149501 ~ 45228504 (-)
G28970 NA other downstream 2563140 44417874 ~ 44418196 (-)
AMCG00008144 phf20,LOC107727854 other downstream 3397923 43510760 ~ 43583413 (-)
AMCG00008233 NA other upstream 566862 47580139 ~ 47607012 (-)
AMCG00008245 si:ch211-199o1.2,LOC105896344,LOC105896343,LOC108441608,LOC107668030,LOC108418094,LOC101067989 other upstream 653365 47666642 ~ 47918462 (-)
G29544 LOC100846954 other upstream 1110648 48123925 ~ 48124682 (-)
AMCG00008256 arfgef2 other upstream 1189344 48202621 ~ 48291443 (-)
AMCG00008255 NA other upstream 1397808 48411085 ~ 48418933 (-)

Expression


Co-expression Network