AMCG00008290 (slc52a3)


Basic Information

Item Value
gene id AMCG00008290
gene name slc52a3
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 50292332 ~ 50293363 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00008290
ATGCCGTATGGGAATATGGCTTATCATCTGTCGGCCACTCTGGGATCCATGGCCAACCCTGTGGCCTGCATCATTGCTATGTTTCTCCCCAAAAGGTCTCTTTTATTCCTAGGAGTCCTGTGTCTGTTTGGGACTGGCTTTGGCACTTACAACATGGCTATGGCAGCTATGAGCCCCTGCCCTCTATTGCAAGGGTCAGCAGCAGGAGTTGCAGTCATTGTAAGCAATTAA

Function

symbol description
slc52a3 Predicted to enable riboflavin transmembrane transporter activity. Predicted to be involved in riboflavin transport. Predicted to be located in plasma membrane. Predicted to be integral component of membrane. Predicted to be integral component of plasma membrane. Human ortholog(s) of this gene implicated in Brown-Vialetto-Van Laere syndrome 1 and Fazio-Londe disease. Orthologous to human SLC52A3 (solute carrier family 52 member 3).

NR:

description
PREDICTED: solute carrier family 52, riboflavin transporter, member 3

GO:

id name namespace
GO:0006810 transport biological_process
GO:0005886 plasma membrane cellular_component
GO:0016021 integral component of membrane cellular_component

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00008290 True 231 mRNA 0.50 2 50292332 50293363

Neighbor

gene id symbol gene type direction distance location
AMCG00008287 scrt2,LOC103139108,LOC102228875 coding downstream 136467 50147817 ~ 50155865 (-)
AMCG00008286 NA coding downstream 173026 50116033 ~ 50119306 (-)
AMCG00008285 tcf15,LOC106567197,LOC107669611,LOC107594541 coding downstream 202565 50087093 ~ 50089767 (-)
AMCG00008284 LOC105895941,LOC108424612,LOC108255211,LOC103042686,LOC104930306,LOC103375199,LOC101473264 coding downstream 262712 49996960 ~ 50029620 (-)
AMCG00008282 NA coding downstream 304757 49947011 ~ 49987575 (-)
AMCG00008289 LOC105022328,LOC106572481,LOC107572061,LOC107683645,LOC108425074,LOC103044311 coding upstream 15415 50308778 ~ 50313435 (-)
AMCG00008293 ptpn1,LOC107669644,LOC107751444,LOC107556311,LOC106522952 coding upstream 104376 50397739 ~ 50406216 (-)
AMCG00008295 LOC107738191,LOC107754892,LOC107590469,LOC107558752,LOC106567112 coding upstream 157724 50451087 ~ 50518539 (-)
AMCG00008297 kcng1,LOC102780788,LOC107711602,LOC107558732 coding upstream 256702 50550065 ~ 50559321 (-)
AMCG00008300 nfatc2 coding upstream 498713 50792076 ~ 50798319 (-)
G30053 NA non-coding downstream 24897 50267076 ~ 50267435 (-)
G30051 NA non-coding downstream 31145 50260756 ~ 50261187 (-)
G30049 NA non-coding downstream 40410 50251710 ~ 50251922 (-)
G30003 NA non-coding downstream 107055 50185032 ~ 50185277 (-)
G29987 NA non-coding downstream 166201 50125640 ~ 50126131 (-)
G30058 NA non-coding upstream 20809 50314172 ~ 50314425 (-)
G30059 NA non-coding upstream 34907 50328270 ~ 50334605 (-)
G30061 NA non-coding upstream 60532 50353895 ~ 50356348 (-)
G30065 NA non-coding upstream 92897 50386260 ~ 50386559 (-)
G30070 NA non-coding upstream 152356 50445719 ~ 50448970 (-)
G30054 NA other downstream 18149 50273738 ~ 50274183 (-)
G29974 LOC101154678 other downstream 238230 50053825 ~ 50054102 (-)
G29928 NA other downstream 387243 49795971 ~ 49905089 (-)
AMCG00008273 gdap1l1,LOC107599436,LOC107664149,LOC107594051,LOC107707014 other downstream 755051 49497400 ~ 49537281 (-)
AMCG00008264 NA other downstream 1039088 49175725 ~ 49253244 (-)
AMCG00008298 NA other upstream 230624 50523987 ~ 50528036 (-)
AMCG00008318 NA other upstream 2035873 52329236 ~ 52339097 (-)
AMCG00008325 znf341,LOC106566899 other upstream 2087693 52381056 ~ 52384567 (-)

Expression


Co-expression Network