AMCG00008300 (nfatc2)


Basic Information

Item Value
gene id AMCG00008300
gene name nfatc2
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 50792076 ~ 50798319 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00008300
CTTCATGGCTACAGGGGGAAGGAGCCACTGGGGCTGCAGATTTTCATCGGGACGGCTGACGAGAGGATCCTGAAACCGCATGCCTTCTACCAGGTCCACCGCATCACAGGCAAAACCGTCACCACCACCAGCTACGAGAAGGTCGTCGGCAGCACCAAGATCCTGGAAATCCCTCTGGAGCCCAAGAACAACATGAAAGCTCTGAGGAATGCGGATATCGAGCTGAGAAAAGGGGAGACGGACATTGGCAGGAAGAACACGAGAGTACGCCTGGTCTTCCGCATTCACATACCTCAACCCGGGGGAGGCGTGGTCTCGCTCCAGGCGGCGTCGAACCCCATTGAGTGCTCCCAGAGATCTGCTCATGAGCTCCCTATGGTTGAGAAGCAGGACACAGAAAGCTGCTCCATCCTTGGGGGGCAACAGATGATCCTGACAGGGCAGAACTTCACCTCTGACTCCAAAGTGGTGTTCACAGAGAAGACACAT

Function

symbol description
nfatc2 Enables phosphatase binding activity and sequence-specific double-stranded DNA binding activity. Involved in several processes, including B cell receptor signaling pathway; negative regulation of vascular associated smooth muscle cell differentiation; and positive regulation of B cell proliferation. Acts upstream of or within positive regulation of transcription, DNA-templated. Located in cytosol and nucleoplasm.

NR:

description
PREDICTED: nuclear factor of activated T-cells, cytoplasmic 2 isoform X4

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00008300 True 489 mRNA 0.56 3 50792076 50798319

Neighbor

gene id symbol gene type direction distance location
AMCG00008297 kcng1,LOC102780788,LOC107711602,LOC107558732 coding downstream 232755 50550065 ~ 50559321 (-)
AMCG00008295 LOC107738191,LOC107754892,LOC107590469,LOC107558752,LOC106567112 coding downstream 273537 50451087 ~ 50518539 (-)
AMCG00008293 ptpn1,LOC107669644,LOC107751444,LOC107556311,LOC106522952 coding downstream 385860 50397739 ~ 50406216 (-)
AMCG00008289 LOC105022328,LOC106572481,LOC107572061,LOC107683645,LOC108425074,LOC103044311 coding downstream 478641 50308778 ~ 50313435 (-)
AMCG00008290 slc52a3 coding downstream 498713 50292332 ~ 50293363 (-)
AMCG00008299 NA coding upstream 12060 50810379 ~ 50813806 (-)
AMCG00008302 atp9a,LOC106567116 coding upstream 41941 50840260 ~ 50916380 (-)
AMCG00008301 NA coding upstream 125733 50924052 ~ 50936800 (-)
AMCG00008303 zfp64,LOC106572631,LOC104953815 coding upstream 228949 51027268 ~ 51036822 (-)
AMCG00008305 NA coding upstream 623155 51421474 ~ 51441540 (-)
G30108 NA non-coding downstream 38902 50750421 ~ 50753174 (-)
G30096 NA non-coding downstream 131900 50659944 ~ 50660176 (-)
G30094 NA non-coding downstream 137563 50654219 ~ 50654513 (-)
G30091 NA non-coding downstream 178173 50613588 ~ 50613903 (-)
G30086 NA non-coding downstream 190026 50601457 ~ 50602050 (-)
G30143 NA non-coding upstream 269821 51068140 ~ 51068561 (-)
G30149 NA non-coding upstream 384355 51182674 ~ 51182933 (-)
G30170 NA non-coding upstream 622328 51420647 ~ 51421417 (-)
G30172 NA non-coding upstream 627012 51425331 ~ 51425584 (-)
G30218 NA non-coding upstream 955764 51754083 ~ 51754304 (-)
AMCG00008298 NA other downstream 264040 50523987 ~ 50528036 (-)
G30054 NA other downstream 517893 50273738 ~ 50274183 (-)
G29974 LOC101154678 other downstream 737974 50053825 ~ 50054102 (-)
G29928 NA other downstream 886987 49795971 ~ 49905089 (-)
AMCG00008273 gdap1l1,LOC107599436,LOC107664149,LOC107594051,LOC107707014 other downstream 1254795 49497400 ~ 49537281 (-)
AMCG00008318 NA other upstream 1530917 52329236 ~ 52339097 (-)
AMCG00008325 znf341,LOC106566899 other upstream 1582737 52381056 ~ 52384567 (-)

Expression


Co-expression Network