AMCG00008313 (cbln4,LOC106567122)


Basic Information

Item Value
gene id AMCG00008313
gene name cbln4,LOC106567122
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 52137169 ~ 52144727 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00008313
ATGCTTCGTAATAAGGCTCTGTTCCCAGTCCTTGTTGTTGTAATGGGCTTGATTTGGTGCATCGAGCTGGTTGGGGCTCAGAACGACACGGAGCCCATCGTCCTGGAGGGCAAATGCCTGGTGGTGTGCGACTCCAACCCGGCCGCCGATGCCAAAGGCTCCTCTCCTCTGGGCATCTCCGTGCGCGCCGCAAACTCCAAGGTGGCTTTTTCAGCCGTGAGGAGCACCAACCATGAACCCTCCGAGATGAGCAACAAGACCCGCATCATCTACTTCGACCAGATTCTCGTGAACGTGGGCAACTATTTCACCTTGGAATCAGTCTTCTTGTCACCCCGGAAAGGGATTTACAGTTTTAACTTTCATGTGATCAAAGTGTACCAGAGCCAGACCATTCAGGTGAACCTGATGCTGAACGGGCGGCCAGTAATCTCGGCCTTCGCAGGAGATAAAGATGTGACTCGCGAAGCAGCCACCAACGGAGTGCTGCTGTACCTTGAAAAAGAGGATAAGGTCTACCTGAAACTGGAGAAGGGGAACCTGGTAGGAGGATGGCAATATTCCACTTTCTCCGGCTTCCTGGTTTTCCCTCTGTAA

Function

symbol description
cbln4 Orthologous to human CBLN4 (cerebellin 4 precursor).

NR:

description
PREDICTED: cerebellin-4

GO: NA

KEGG:

id description
K24235 CBLN; cerebellin

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00008313 True 597 mRNA 0.53 3 52137169 52144727

Neighbor

gene id symbol gene type direction distance location
AMCG00008312 NA coding downstream 67360 52068482 ~ 52069809 (-)
AMCG00008311 NA coding downstream 393371 51743409 ~ 51743798 (-)
AMCG00008307 NA coding downstream 621769 51510754 ~ 51515400 (-)
AMCG00008306 NA coding downstream 639957 51471219 ~ 51497212 (-)
AMCG00008305 NA coding downstream 695629 51421474 ~ 51441540 (-)
AMCG00008314 NA coding upstream 44455 52189182 ~ 52250096 (-)
AMCG00008322 NA coding upstream 107950 52252677 ~ 52293414 (-)
AMCG00008321 NA coding upstream 200302 52345029 ~ 52345527 (-)
AMCG00008319 NA coding upstream 211774 52356501 ~ 52362043 (-)
AMCG00008317 pxmp4,LOC103464829 coding upstream 221426 52366153 ~ 52370382 (-)
G30233 NA non-coding downstream 35849 52101040 ~ 52101320 (-)
G30231 NA non-coding downstream 43514 52091632 ~ 52093655 (-)
G30228 NA non-coding downstream 69713 52067208 ~ 52067456 (-)
G30225 NA non-coding downstream 207790 51929106 ~ 51929379 (-)
G30220 NA non-coding downstream 291399 51845495 ~ 51845770 (-)
G30237 NA non-coding upstream 12063 52156790 ~ 52157079 (-)
G30266 NA non-coding upstream 134130 52278857 ~ 52279119 (-)
G30270 NA non-coding upstream 144163 52288890 ~ 52289123 (-)
G30275 NA non-coding upstream 180978 52325705 ~ 52326037 (-)
G30276 NA non-coding upstream 181434 52326161 ~ 52326391 (-)
AMCG00008298 NA other downstream 1609133 50523987 ~ 50528036 (-)
G30054 NA other downstream 1862986 50273738 ~ 50274183 (-)
G29974 LOC101154678 other downstream 2083067 50053825 ~ 50054102 (-)
G29928 NA other downstream 2232080 49795971 ~ 49905089 (-)
AMCG00008273 gdap1l1,LOC107599436,LOC107664149,LOC107594051,LOC107707014 other downstream 2599888 49497400 ~ 49537281 (-)
AMCG00008318 NA other upstream 184509 52329236 ~ 52339097 (-)
AMCG00008325 znf341,LOC106566899 other upstream 236329 52381056 ~ 52384567 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_021908 cbln4 coding NC_007134.7 CM002907.2 37955041 ~ 37974323 (+)