G21891



Basic Information


Item Value
gene id G21891
gene name NA
gene type unknown
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 7374323 ~ 7378946 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>TU27445
AGCCGCAGTCCCGGGAAGAGCCGCTCACGCCCCGCACCTGAGACCGGCGCGCAACGCGGAAGTGCCAGGAGACGCTGCTGCAGAGTCGCGGACCGGCGCGGTGCGAGACGCGGGGATCACAGCACAGCCAGCGCGGGACGGCAGCGGCATGTCAGACGCCACGAATAAGCGGCACACGGGCCAGGCCTGCATTGAGCTCAGAGAGACCCTGAATCGGACCCAGCATGGAAAAGACTTGGAGCAGTGTGACTTCGTTCTGGTCAGCAAGAACCTGGAGGCTGAGCCGGACTGCGAGGCTCTCCGGAAGCAGGTGGCCTTCATCGAGGAGCTGACGAAGAAGGACTTTGACATAAAG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU27445 True 355 TUCP 0.64 3 7374323 7378946
Loading

Neighbor


gene id symbol gene type direction distance location
AMCG00007198 NA coding upstream 3480 7367233 ~ 7370843 (+)
AMCG00007195 NA coding upstream 118211 7254895 ~ 7256112 (+)
AMCG00007194 NA coding upstream 165795 7184792 ~ 7208528 (+)
AMCG00007186 NA coding upstream 610549 6759610 ~ 6763774 (+)
AMCG00007187 NA coding upstream 638163 6723309 ~ 6736160 (+)
AMCG00007203 NA coding downstream 19147 7398093 ~ 7404817 (+)
AMCG00007209 LOC107553077,LOC107557708,LOC107740430 coding downstream 134119 7513065 ~ 7513972 (+)
AMCG00007208 LOC108430817 coding downstream 156621 7535567 ~ 7546694 (+)
AMCG00007216 LOC102797294,LOC104954180,LOC108251745 coding downstream 261505 7640451 ~ 7650031 (+)
AMCG00007218 NA coding downstream 278586 7657532 ~ 7659237 (+)
G21876 NA non-coding upstream 46581 7324424 ~ 7327742 (+)
G21828 NA non-coding upstream 506087 6868015 ~ 6868236 (+)
G21814 NA non-coding upstream 632445 6736736 ~ 6741878 (+)
G21806 NA non-coding upstream 669704 6704409 ~ 6704619 (+)
G21802 fibin,LOC103373419,LOC104955317,LOC107740499,LOC107553104 non-coding upstream 683687 6687689 ~ 6690636 (+)
G21894 NA non-coding downstream 7773 7386719 ~ 7388175 (+)
G21902 NA non-coding downstream 33671 7412617 ~ 7467225 (+)
G21924 NA non-coding downstream 117747 7496693 ~ 7497099 (+)
G21949 NA non-coding downstream 152617 7531563 ~ 7531770 (+)
G21985 NA non-coding downstream 227633 7606579 ~ 7607071 (+)
AMCG00007196 svip other upstream 155848 7211564 ~ 7218475 (+)
AMCG00007160 NA other upstream 1598867 5757677 ~ 5775456 (+)
AMCG00007154 ptpmt1,LOC102795413 other upstream 1702178 5668196 ~ 5672145 (+)
AMCG00007148 NA other upstream 1794029 5565941 ~ 5580294 (+)
AMCG00007147 fbxo3 other upstream 1812169 5552393 ~ 5562154 (+)
AMCG00007232 rpl27a,LOC107687759,LOC107726310 other downstream 768452 8147398 ~ 8183421 (+)
AMCG00007243 rbtn1,lmo1,LOC108713718,LOC107593328,LOC106609843,LOC107725665,LOC107085592 other downstream 988490 8367436 ~ 8396242 (+)
AMCG00007242 NA other downstream 1052156 8431102 ~ 8451582 (+)
AMCG00007253 calcb,LOC106584617,LOC104951332,LOC107090894,LOC106922915,LOC106950942,LOC103461098 other downstream 1319037 8697983 ~ 8711311 (+)
G22372 NA other downstream 2057578 9436524 ~ 9499728 (+)

Expression


G21891 Expression in all Baseline Samples

Bar chart with 16 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G21891 Expression in each Bioproject

Bar chart with 6 bars.
G21891 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network