G22211



Basic Information


Item Value
gene id G22211
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 8484262 ~ 8484504 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>TU27842
atacaccgatcagccataacattatgaccactgacaggtgaagtgaataacactgataatctcgttatcatggcacctgtcagtgggtgggatatattaggcagcaagtgaacattttgtcctcaaagttgatgtgttagaagcaggaaaaatgggcagcgtaaggatctgagcgactttgacaagggccaaattgtgacggctagacgactgggtcagagcatctccaaaactgcagctctt

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU27842 True 243 lncRNA 0.45 1 8484262 8484504
Loading

Neighbor


gene id symbol gene type direction distance location
AMCG00007241 NA coding upstream 232443 8242184 ~ 8251819 (+)
AMCG00007245 rergl,LOC104925113 coding upstream 262626 8217578 ~ 8221636 (+)
AMCG00007244 NA coding upstream 279141 8187419 ~ 8205121 (+)
AMCG00007231 NA coding upstream 382474 8098065 ~ 8101788 (+)
AMCG00007230 tmem9b,LOC107700603,LOC107754675,LOC107585953,LOC107750540,LOC107674442 coding upstream 388080 8092029 ~ 8096182 (+)
AMCG00007252 NA coding downstream 187985 8672489 ~ 8687381 (+)
AMCG00007250 insc,LOC106561064 coding downstream 266663 8751167 ~ 8762076 (+)
AMCG00007251 insc coding downstream 293465 8777969 ~ 8784734 (+)
AMCG00007254 NA coding downstream 396380 8880884 ~ 8957404 (+)
AMCG00007257 NA coding downstream 694399 9178903 ~ 9185848 (+)
G22209 NA non-coding upstream 33284 8450767 ~ 8450978 (+)
G22208 NA non-coding upstream 33768 8450084 ~ 8450494 (+)
G22204 NA non-coding upstream 38712 8444925 ~ 8445550 (+)
G22192 NA non-coding upstream 229607 8253893 ~ 8254655 (+)
G22076 NA non-coding upstream 583087 7900779 ~ 7901175 (+)
G22212 NA non-coding downstream 7657 8492161 ~ 8492457 (+)
G22230 NA non-coding downstream 107635 8592139 ~ 8604058 (+)
G22285 NA non-coding downstream 491597 8976101 ~ 8978196 (+)
G22344 NA non-coding downstream 851214 9335718 ~ 9339100 (+)
G22364 NA non-coding downstream 911717 9396221 ~ 9396480 (+)
AMCG00007242 NA other upstream 32680 8431102 ~ 8451582 (+)
AMCG00007243 rbtn1,lmo1,LOC108713718,LOC107593328,LOC106609843,LOC107725665,LOC107085592 other upstream 88020 8367436 ~ 8396242 (+)
AMCG00007232 rpl27a,LOC107687759,LOC107726310 other upstream 300841 8147398 ~ 8183421 (+)
G21891 NA other upstream 1105316 7374323 ~ 7378946 (+)
AMCG00007196 svip other upstream 1265787 7211564 ~ 7218475 (+)
AMCG00007253 calcb,LOC106584617,LOC104951332,LOC107090894,LOC106922915,LOC106950942,LOC103461098 other downstream 213479 8697983 ~ 8711311 (+)
G22372 NA other downstream 952020 9436524 ~ 9499728 (+)
AMCG00007278 NA other downstream 1452416 9936920 ~ 9965267 (+)
AMCG00007307 clg19h11orf96 other downstream 2126692 10611196 ~ 10613104 (+)
AMCG00007337 NA other downstream 5994169 14478673 ~ 14489692 (+)

Expression


G22211 Expression in all Baseline Samples

Bar chart with 16 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 100.
End of interactive chart.

G22211 Expression in each Bioproject

Bar chart with 7 bars.
G22211 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 250.
End of interactive chart.

Co-expression Network