G22738



Basic Information


Item Value
gene id G22738
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 11540983 ~ 11541524 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>TU28528
caataatcatttattttgacaaaaataggaaactaatatcattcaattatattactgaaaataagtaatattaagcttctgctggattacagtaagaaacagataatacccattttcttctttctcctcacagtaaagcttataggccagtctggtcaggcaggaagcggtgtgtgtctctctgtctctcctctccagctctgtcttgtgtctcgttgcaggatgaagaagttaagagaactcaaattctctttgttttcccttttataaggtttccttccaaccaatagcattttgccaccaccatgacttgggtgccttatgctaaagtaatttagaagtgggggtcattttgaatttggctaggagccaatcagaggacaggtccctttttggtctctggtcataaagatagggttaccagggctaccaggggctaccagggaacttagataaaagggaggaggtctgtttcctctaccaaaccagatggtatagaatttcccatagaaaaatatattctaacaaataatatcttacaa

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU28528 True 542 lncRNA 0.39 1 11540983 11541524
Loading

Neighbor


gene id symbol gene type direction distance location
AMCG00007310 NA coding upstream 763276 10758834 ~ 10777707 (+)
AMCG00007306 rag1 coding upstream 797308 10739045 ~ 10743675 (+)
AMCG00007305 NA coding upstream 873688 10660181 ~ 10667295 (+)
AMCG00007308 NA coding upstream 885994 10628350 ~ 10654989 (+)
AMCG00007304 NA coding upstream 931968 10577246 ~ 10609015 (+)
AMCG00007311 NA coding downstream 47110 11588634 ~ 11603718 (+)
AMCG00007317 NA coding downstream 2000232 13541756 ~ 13551121 (+)
AMCG00007321 mrpl21,LOC106561938 coding downstream 2081620 13623144 ~ 13624807 (+)
AMCG00007322 NA coding downstream 2105103 13646627 ~ 13647013 (+)
AMCG00007328 NA coding downstream 2433781 13975305 ~ 13981853 (+)
G22730 NA non-coding upstream 18625 11512153 ~ 11522358 (+)
G22720 NA non-coding upstream 310590 11229825 ~ 11230393 (+)
G22712 NA non-coding upstream 429260 11111343 ~ 11111723 (+)
G22652 NA non-coding upstream 855915 10626674 ~ 10685068 (+)
G22596 NA non-coding upstream 1219125 10320469 ~ 10321858 (+)
G22741 NA non-coding downstream 29428 11570952 ~ 11573862 (+)
G22756 NA non-coding downstream 181968 11723492 ~ 11723746 (+)
G22760 NA non-coding downstream 271341 11812865 ~ 11813093 (+)
G22769 NA non-coding downstream 323912 11865436 ~ 11866024 (+)
G22770 NA non-coding downstream 324639 11866163 ~ 11866484 (+)
AMCG00007307 clg19h11orf96 other upstream 927879 10611196 ~ 10613104 (+)
AMCG00007278 NA other upstream 1575716 9936920 ~ 9965267 (+)
G22372 NA other upstream 2041255 9436524 ~ 9499728 (+)
AMCG00007253 calcb,LOC106584617,LOC104951332,LOC107090894,LOC106922915,LOC106950942,LOC103461098 other upstream 2829672 8697983 ~ 8711311 (+)
AMCG00007242 NA other upstream 3089401 8431102 ~ 8451582 (+)
AMCG00007337 NA other downstream 2937149 14478673 ~ 14489692 (+)
AMCG00007352 NA other downstream 3735187 15276711 ~ 15287960 (+)
AMCG00007350 tsg101 other downstream 3825137 15366661 ~ 15379965 (+)
AMCG00007379 NA other downstream 5082866 16624390 ~ 16662700 (+)
AMCG00007417 NA other downstream 6657094 18198618 ~ 18201960 (+)

Expression


G22738 Expression in all Baseline Samples

Bar chart with 16 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G22738 Expression in each Bioproject

Bar chart with 4 bars.
G22738 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.

Co-expression Network