G22770



Basic Information


Item Value
gene id G22770
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 11866163 ~ 11866484 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>TU28561
ccgtcaaatcttgggtgagaacctccttccctcagccagggcattgaaaatgggtcgtggatgggtattccagcatgacaatgacccaaaacacacagccaaggcaacaaaggagtggctcaagaagaagcacattaaggtcctggagtggcctagccagtctccagaccttaatcccatagaaaatctgtggttcgagttgccaaacgtcagcctcgaaaccttaatgacttggagaggatctgcaaagaggagtgggacaaaatccctcctgagatgtgtgcaaacctggtggccaactacaagaaacatctgacctctg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU28561 True 322 lncRNA 0.50 1 11866163 11866484
Loading

Neighbor


gene id symbol gene type direction distance location
AMCG00007311 NA coding upstream 262445 11588634 ~ 11603718 (+)
AMCG00007310 NA coding upstream 1088456 10758834 ~ 10777707 (+)
AMCG00007306 rag1 coding upstream 1122488 10739045 ~ 10743675 (+)
AMCG00007305 NA coding upstream 1198868 10660181 ~ 10667295 (+)
AMCG00007308 NA coding upstream 1211174 10628350 ~ 10654989 (+)
AMCG00007317 NA coding downstream 1675272 13541756 ~ 13551121 (+)
AMCG00007321 mrpl21,LOC106561938 coding downstream 1756660 13623144 ~ 13624807 (+)
AMCG00007322 NA coding downstream 1780143 13646627 ~ 13647013 (+)
AMCG00007328 NA coding downstream 2108821 13975305 ~ 13981853 (+)
AMCG00007327 NA coding downstream 2182909 14049393 ~ 14064082 (+)
G22769 NA non-coding upstream 139 11865436 ~ 11866024 (+)
G22760 NA non-coding upstream 53070 11812865 ~ 11813093 (+)
G22756 NA non-coding upstream 142417 11723492 ~ 11723746 (+)
G22741 NA non-coding upstream 292301 11570952 ~ 11573862 (+)
G22738 NA non-coding upstream 324639 11540983 ~ 11541524 (+)
G22773 NA non-coding downstream 11021 11877505 ~ 11877862 (+)
G22775 NA non-coding downstream 12916 11879400 ~ 11879606 (+)
G22781 NA non-coding downstream 31059 11897543 ~ 11898137 (+)
G22816 NA non-coding downstream 1086391 12952875 ~ 12953096 (+)
G22837 NA non-coding downstream 1485142 13351626 ~ 13351919 (+)
AMCG00007307 clg19h11orf96 other upstream 1253059 10611196 ~ 10613104 (+)
AMCG00007278 NA other upstream 1900896 9936920 ~ 9965267 (+)
G22372 NA other upstream 2366435 9436524 ~ 9499728 (+)
AMCG00007253 calcb,LOC106584617,LOC104951332,LOC107090894,LOC106922915,LOC106950942,LOC103461098 other upstream 3154852 8697983 ~ 8711311 (+)
AMCG00007242 NA other upstream 3414581 8431102 ~ 8451582 (+)
AMCG00007337 NA other downstream 2612189 14478673 ~ 14489692 (+)
AMCG00007352 NA other downstream 3410227 15276711 ~ 15287960 (+)
AMCG00007350 tsg101 other downstream 3500177 15366661 ~ 15379965 (+)
AMCG00007379 NA other downstream 4757906 16624390 ~ 16662700 (+)
AMCG00007417 NA other downstream 6332134 18198618 ~ 18201960 (+)

Expression


G22770 Expression in all Baseline Samples

Bar chart with 16 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G22770 Expression in each Bioproject

Bar chart with 7 bars.
G22770 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 250.
End of interactive chart.

Co-expression Network