G22844



Basic Information


Item Value
gene id G22844
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 13483495 ~ 13492334 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>TU28640
ATTACTGTGCAAGCAGTAGTCAGAAAAAGCTTTATACTTCTTGCTTGTTCCTTTGAAGCTTTTTTTCACTGCGCTTCAGCTTCCTGGGTTTTTATCCTCAGTTTCCATTAAACCCACTTGACTGTCCTGCAAGTTAGAGAAGCAGTCAGATGTTTTCTGGAAACGCAATAAAGCAACGATGGAAGTTGAAACTGAACACACACCTTNN

Function


GO: NA

KEGG:

id description
ko04913 Ovarian steroidogenesis

RNA


RNA id representative length rna type GC content exon number start site end site
TU28640 True 208 lncRNA 0.40 2 13483495 13492334

Neighbor


gene id symbol gene type direction distance location
AMCG00007311 NA coding upstream 1879777 11588634 ~ 11603718 (+)
AMCG00007310 NA coding upstream 2705788 10758834 ~ 10777707 (+)
AMCG00007306 rag1 coding upstream 2739820 10739045 ~ 10743675 (+)
AMCG00007305 NA coding upstream 2816200 10660181 ~ 10667295 (+)
AMCG00007308 NA coding upstream 2828506 10628350 ~ 10654989 (+)
AMCG00007317 NA coding downstream 49422 13541756 ~ 13551121 (+)
AMCG00007321 mrpl21,LOC106561938 coding downstream 130810 13623144 ~ 13624807 (+)
AMCG00007322 NA coding downstream 154293 13646627 ~ 13647013 (+)
AMCG00007328 NA coding downstream 482971 13975305 ~ 13981853 (+)
AMCG00007327 NA coding downstream 557059 14049393 ~ 14064082 (+)
G22839 NA non-coding upstream 129039 13353613 ~ 13354456 (+)
G22837 NA non-coding upstream 131576 13351626 ~ 13351919 (+)
G22816 NA non-coding upstream 530399 12952875 ~ 12953096 (+)
G22781 NA non-coding upstream 1585358 11897543 ~ 11898137 (+)
G22775 NA non-coding upstream 1603889 11879400 ~ 11879606 (+)
G22887 NA non-coding downstream 139212 13631546 ~ 13631960 (+)
G22888 NA non-coding downstream 145090 13637424 ~ 13637624 (+)
G22893 NA non-coding downstream 184623 13676957 ~ 13677701 (+)
G22930 LOC100846954 non-coding downstream 453304 13945638 ~ 13946065 (+)
G22932 NA non-coding downstream 529757 14022091 ~ 14022317 (+)
AMCG00007307 clg19h11orf96 other upstream 2870391 10611196 ~ 10613104 (+)
AMCG00007278 NA other upstream 3518228 9936920 ~ 9965267 (+)
G22372 NA other upstream 3983767 9436524 ~ 9499728 (+)
AMCG00007253 calcb,LOC106584617,LOC104951332,LOC107090894,LOC106922915,LOC106950942,LOC103461098 other upstream 4772184 8697983 ~ 8711311 (+)
AMCG00007242 NA other upstream 5031913 8431102 ~ 8451582 (+)
AMCG00007337 NA other downstream 986339 14478673 ~ 14489692 (+)
AMCG00007352 NA other downstream 1784377 15276711 ~ 15287960 (+)
AMCG00007350 tsg101 other downstream 1874327 15366661 ~ 15379965 (+)
AMCG00007379 NA other downstream 3132056 16624390 ~ 16662700 (+)
AMCG00007417 NA other downstream 4706284 18198618 ~ 18201960 (+)

Expression


G22844 Expression in all Baseline Samples

Bar chart with 16 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 300.
End of interactive chart.

G22844 Expression in each Bioproject

Bar chart with 4 bars.
G22844 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network