G25079 (mfap1)


Basic Information

Item Value
gene id G25079
gene name mfap1
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 24050148 ~ 24050436 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU31454
ACTTACGCTTCCCGGGCCTCGCGATCTCGCTTGATGCGCTTGAGCTCCCGGACCTTCCAGGCCTCGTACTCCTCCTCCTCGTTCTCTCCGTCCGTGTCGAGGGCATCGAGTGCGGCCAGTGTGCGCCGGTTCTCCTCAAACTCCTTCTTGGCCTCCTCCTCCACGATCTTCAGGGTGTAGCGCCGCCGCTCCTCCACCTGCTTCTTAGCCTCGACCTCCAACTCCTTCTGCTTCAGCTCCTCCGCCTCGCGCTCGGCCACCGTCACGCGATCCTTCCTGCAAGAACCAG

Function

symbol description
mfap1 Predicted to be involved in mRNA splicing, via spliceosome. Predicted to be part of U2-type spliceosomal complex. Orthologous to human MFAP1 (microfibril associated protein 1).

NR:

description
PREDICTED: microfibrillar-associated protein 1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU31454 True 289 lncRNA 0.63 1 24050148 24050436

Neighbor

gene id symbol gene type direction distance location
AMCG00007624 vps33b coding downstream 4776 24032553 ~ 24045372 (-)
AMCG00007626 NA coding downstream 19578 24022553 ~ 24030570 (-)
AMCG00007627 LOC106587701 coding downstream 28203 24017465 ~ 24021945 (-)
AMCG00007623 NA coding downstream 38520 24004839 ~ 24011628 (-)
AMCG00007628 NA coding downstream 52756 23996928 ~ 23997392 (-)
AMCG00007625 NA coding upstream 2036 24052472 ~ 24055090 (-)
AMCG00007629 NA coding upstream 27716 24078152 ~ 24100673 (-)
AMCG00007630 crtc3,LOC107701275,LOC107695354,LOC107757665,LOC107596420 coding upstream 64119 24114555 ~ 24148021 (-)
AMCG00007635 iqgap1,LOC106562619,LOC107730269 coding upstream 99908 24150344 ~ 24186890 (-)
AMCG00007634 NA coding upstream 201030 24251466 ~ 24256041 (-)
G25078 NA non-coding downstream 75 24049815 ~ 24050073 (-)
G25077 NA non-coding downstream 364 24049553 ~ 24049784 (-)
G25076 mfap1,LOC102796914 non-coding downstream 711 24049224 ~ 24049437 (-)
G25075 NA non-coding downstream 1668 24047660 ~ 24048480 (-)
G25058 NA non-coding downstream 18844 24031035 ~ 24031304 (-)
G25175 NA non-coding upstream 296663 24347099 ~ 24347419 (-)
G25176 NA non-coding upstream 299594 24350030 ~ 24354310 (-)
G25177 NA non-coding upstream 317733 24368169 ~ 24368373 (-)
G25239 NA non-coding upstream 382644 24433080 ~ 24507819 (-)
G25248 NA non-coding upstream 447929 24498365 ~ 24542158 (-)
G25026 NA other downstream 77483 23971671 ~ 23972665 (-)
AMCG00007594 zfand6,zfand5,zfand5a,LOC105015049 other downstream 629845 23406928 ~ 23420303 (-)
AMCG00007572 LOC107703942,LOC103366351,LOC107665298,LOC107726337 other downstream 1473694 22561496 ~ 22576454 (-)
AMCG00007565 gatm other downstream 1691702 22340599 ~ 22358446 (-)
AMCG00007500 NA other downstream 3577229 20462504 ~ 20472919 (-)
AMCG00007637 NA other upstream 212254 24262690 ~ 24281564 (-)
G25422 NA other upstream 1213896 25264332 ~ 25264951 (-)
AMCG00007684 shf,LOC108430988 other upstream 1580356 25630792 ~ 25631592 (-)
AMCG00007687 LOC107703195,LOC107589318,LOC103130145 other upstream 2003328 26053764 ~ 26070848 (-)
AMCG00007704 NA other upstream 3307295 27357731 ~ 27370519 (-)

Expression


Co-expression Network