G25148 (cdkn2aip,LOC107757748,LOC107695352,LOC107730231,LOC107596431,LOC107701282)


Basic Information

Item Value
gene id G25148
gene name cdkn2aip,LOC107757748,LOC107695352,LOC107730231,LOC107596431,LOC107701282
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 24254790 ~ 24255913 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU31536
CGGCAACCCAGGAAAACGTGGTTAGCCCATGCCATAGAGAGCGCGAGTAGGCGGTCCAGGCTGGGGCTGGGGATGCCTGGCTGGATGGTGGGAAAGACCTCCATATTTCGCAGGATGAACTCACGCCTGGCGCTCCACTGCTTGTCCGTCTCACAATGCCCCCGGAGAGATTCCACCCACTGCGCCTGGTGGGGGTTCTGACGGAGGAACTCGGCTACAATGTCCTCTCCGCTCCTCCCCTCCGCCATCACTGCAACACCATGTAGGCTTTAGTGTTAATCAGCACCTGGTACCCTTCTGCTGGGATTCCCAACAGCTGTCCTTGTTGCCAGAATTGAACATTTCCAACTAGGTCTCCCCTTTAATATACAATGCCAGTGGCTTCACTGCTAACACTGCAGCCATGCAACCTCTCCTGTAGCGCAACTCATGCCGTGAAA

Function

symbol description
cdkn2aip Involved in positive regulation of developmental growth; positive regulation of hemopoiesis; and positive regulation of mesoderm development. Acts upstream of or within positive regulation of canonical Wnt signaling pathway. Orthologous to human CDKN2AIP (CDKN2A interacting protein).

NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU31536 True 440 lncRNA 0.56 2 24254790 24255913

Neighbor

gene id symbol gene type direction distance location
AMCG00007633 LOC106526729,LOC108249217,LOC107091076,LOC102219664 coding upstream 24205 24229522 ~ 24230585 (+)
AMCG00007622 serinc4 coding upstream 177442 24056196 ~ 24077348 (+)
AMCG00007618 mfap1 coding upstream 202963 24048234 ~ 24051827 (+)
AMCG00007620 hddc3,LOC107757611 coding upstream 210389 24041906 ~ 24044401 (+)
AMCG00007621 NA coding upstream 238177 24013330 ~ 24016613 (+)
AMCG00007632 tubgcp4,LOC107695351 coding downstream 233 24256146 ~ 24261899 (+)
AMCG00007636 map1a,LOC106584644 coding downstream 80648 24336561 ~ 24349947 (+)
AMCG00007638 NA coding downstream 193409 24449322 ~ 24461405 (+)
AMCG00007641 LOC107733946,LOC107685211,LOC108428500,LOC107737001,LOC103353203,LOC107662289 coding downstream 266552 24522465 ~ 24536808 (+)
AMCG00007639 NA coding downstream 316973 24572886 ~ 24574030 (+)
G25138 NA non-coding upstream 25880 24228636 ~ 24228910 (+)
G25134 NA non-coding upstream 41346 24211682 ~ 24213444 (+)
G25103 NA non-coding upstream 100942 24150343 ~ 24153848 (+)
G25084 NA non-coding upstream 167486 24085407 ~ 24087304 (+)
G25069 NA non-coding upstream 208181 24044989 ~ 24046609 (+)
G25196 NA non-coding downstream 185384 24441297 ~ 24469767 (+)
G25197 LOC105908101 non-coding downstream 215126 24471039 ~ 24473147 (+)
G25203 LOC105015055 non-coding downstream 228373 24484286 ~ 24490748 (+)
G25209 NA non-coding downstream 298355 24554268 ~ 24564852 (+)
G25300 NA non-coding downstream 561429 24817342 ~ 24861868 (+)
AMCG00007631 NA other upstream 60309 24192221 ~ 24194481 (+)
AMCG00007604 asb7,LOC107755647,LOC107662256,LOC107742335,LOC106562481,LOC102792420 other upstream 584711 23657850 ~ 23670079 (+)
G24824 mesdc1,LOC107553753,LOC107691577,LOC107709503,LOC107662264 other upstream 1061269 23189460 ~ 23193521 (+)
AMCG00007585 star5,stard5,LOC104953929 other upstream 1115269 23133811 ~ 23139521 (+)
G24606 NA other upstream 1971832 22281700 ~ 22282958 (+)
AMCG00007640 NA other downstream 220574 24476487 ~ 24499650 (+)
G25822 NA other downstream 3827909 28083822 ~ 28094741 (+)
AMCG00007735 LOC104966693,LOC107388733,LOC105916711,LOC106514397,LOC105007422,LOC106561846 other downstream 4182731 28438644 ~ 28454707 (+)
AMCG00007754 NA other downstream 4426258 28682171 ~ 28700062 (+)
AMCG00007763 tbc1d2b other downstream 4644145 28900058 ~ 28911566 (+)

Expression


Co-expression Network