G27949



Basic Information


Item Value
gene id G27949
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 39842331 ~ 39847044 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>TU34987
TGAATCCAAACACCCACCATGTGTGCGGCGTGTCTCAGGTGAGGATACGGGATGAAGCTGTACTCCTGCAACCCGGGATAAGACACGGGCAGCCCGGCAACAGCAGAGAGGTGAGGCGCCGGGGGGACCCCTGTCGGGCACCCCACAACCAAAGTCTGATATCCAGGCGGCATGCTGAGGTTTTTCCCAAGGAAGAAATCTGCAAATCCAGTGTGCGGCGCAGGCATGCTTCTCGTCGGGCTGTCGGAGTCGGAGTGCCGC
>TU34988
TGAATCCAAACACCCACCATGTGTGCGGCGTGTCTCAGGTGAGGATACGGGATGAAGCTGTACTCCTGCAACCCGGGATAAGACACGGGCAGCCCGGCAACAGCAGAGAGGTGAGGCGCCGGGGGGACCCCTGTCGGGCACCCCACAACCAAAGTCTGATATCCAGGCGGCATGCTGAGGTTTTTCCCAAGGAAGAAATCTGCAAATCCAGTGTGCGGCGCAGGCATGCTTCTCGTCGGGCTGTCGGAGTCGGAGTGCCGC

Function


GO:

id name namespace
GO:0031231 intrinsic component of peroxisomal membrane cellular_component
GO:0005777 peroxisome cellular_component
GO:0005778 peroxisomal membrane cellular_component
GO:0005779 integral component of peroxisomal membrane cellular_component
GO:0044438 obsolete microbody part cellular_component
GO:0044439 obsolete peroxisomal part cellular_component
GO:0031903 microbody membrane cellular_component
GO:0042579 microbody cellular_component

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU34987 True 261 lncRNA 0.61 2 39842331 39847044
TU34988 False 261 lncRNA 0.61 2 39842331 39847044

Neighbor


gene id symbol gene type direction distance location
AMCG00008019 NA coding downstream 214229 39592332 ~ 39628102 (-)
AMCG00008016 NA coding downstream 275777 39557576 ~ 39566554 (-)
AMCG00008014 pcif1 coding downstream 300385 39528389 ~ 39541946 (-)
AMCG00008017 LOC107744395,LOC107587627 coding downstream 317005 39518444 ~ 39525326 (-)
AMCG00008018 ube2c,LOC107744406 coding downstream 325064 39513466 ~ 39517267 (-)
AMCG00008025 tfap2c,LOC106565286 coding upstream 82487 39929531 ~ 39945352 (-)
AMCG00008026 rtfdc1,LOC106565284 coding upstream 134568 39981612 ~ 39984433 (-)
AMCG00008029 LOC106565282 coding upstream 139884 39986928 ~ 40008602 (-)
AMCG00008028 LOC108233014,LOC100703573,LOC101171829 coding upstream 203985 40051029 ~ 40061973 (-)
AMCG00008032 NA coding upstream 230464 40077508 ~ 40091201 (-)
G27927 NA non-coding downstream 50847 39790546 ~ 39791484 (-)
G27904 NA non-coding downstream 77914 39763930 ~ 39764417 (-)
G27833 NA non-coding downstream 386473 39455040 ~ 39455858 (-)
G27686 NA non-coding downstream 919643 38920970 ~ 38922688 (-)
G27668 NA non-coding downstream 986554 38855548 ~ 38855777 (-)
G28036 NA non-coding upstream 430119 40277163 ~ 40277647 (-)
G28095 NA non-coding upstream 780733 40627777 ~ 40632764 (-)
G28110 NA non-coding upstream 812837 40659881 ~ 40663760 (-)
G28119 NA non-coding upstream 816873 40663917 ~ 40667862 (-)
G28139 NA non-coding upstream 901262 40748306 ~ 40750443 (-)
G27861 LOC797048,LOC108410937,LOC107740256,LOC105897858 other downstream 337739 39500321 ~ 39504592 (-)
AMCG00007993 dynlrb1,LOC106565026 other downstream 750436 39088557 ~ 39091895 (-)
G27720 NA other downstream 786652 39054153 ~ 39055679 (-)
AMCG00007990 ppp1r16b,LOC106566117,LOC107558141 other downstream 792734 39032787 ~ 39049597 (-)
AMCG00007983 NA other downstream 904668 38924581 ~ 38937663 (-)
AMCG00008042 NA other upstream 421228 40268272 ~ 40288574 (-)
G28202 NA other upstream 1169115 41016159 ~ 41017248 (-)
AMCG00008069 rps21 other upstream 1352445 41199489 ~ 41201825 (-)
AMCG00008076 NA other upstream 1558747 41405791 ~ 41412224 (-)
AMCG00008085 NA other upstream 1999889 41846933 ~ 41849954 (-)

Expression



Co-expression Network