G28931 (col9a3,LOC106571930)


Basic Information

Item Value
gene id G28931
gene name col9a3,LOC106571930
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 44053965 ~ 44056608 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU36226
CCTCGGCCCAGCTTCTCCCCTCTCTCCGGGAACACCCTGAACGCCTGGAATACCTGGCTCTCCAGACGGGCCGGGCTCTCCACTTTTTCCTTGGTCACCACTCTGCCCTTTCGATCCTTTGGTTCCAGCCTTTCCTTGTAATCCAGGAAGGCCATTGGGACCTTTCTCCCCTGGGACTCCAGGTCGCCCGGCATCCCCTTTCTCTCCGTCTGTTCCCGGAGTCCCATCTTTTCCATCCCGACCAGGAATGCCTGGCTCTCCTTTAGGCCCAGATCCCCCTGGCACTCCTTTCGGACCTGGTTTTCCAATGTCACCCTTTGGTCCTTTGAAC

Function

symbol description
col9a3 Predicted to be an extracellular matrix structural constituent. Predicted to be involved in extracellular matrix organization and skeletal system development. Predicted to be active in cytoplasm; extracellular matrix; and extracellular space. Is expressed in several structures, including head mesenchyme; hypochord; mesoderm; notochord; and pectoral fin. Human ortholog(s) of this gene implicated in multiple epiphyseal dysplasia 3 and osteochondrodysplasia. Orthologous to human COL9A3 (collagen type IX alpha 3 chain).

NR:

description
PREDICTED: collagen alpha-3(IX) chain-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU36226 True 331 lncRNA 0.59 7 44053965 44056608

Neighbor

gene id symbol gene type direction distance location
AMCG00008153 NA coding upstream 9155 44040778 ~ 44044810 (+)
AMCG00008156 NA coding upstream 17838 44034386 ~ 44036127 (+)
AMCG00008155 NA coding upstream 19625 44001734 ~ 44034340 (+)
AMCG00008154 NA coding upstream 54132 43976301 ~ 43999833 (+)
AMCG00008149 LOC106572085,LOC107705722 coding upstream 160867 43854025 ~ 43893098 (+)
AMCG00008157 NA coding downstream 49847 44106455 ~ 44131719 (+)
AMCG00008160 NA coding downstream 203367 44259975 ~ 44268323 (+)
AMCG00008167 NA coding downstream 520764 44577372 ~ 44653905 (+)
AMCG00008162 cdh4,LOC106571924 coding downstream 609028 44665636 ~ 44683700 (+)
AMCG00008161 lsm14a,lsm14b,LOC105018105 coding downstream 687022 44743630 ~ 44748571 (+)
G28862 NA non-coding upstream 158014 43894109 ~ 43895951 (+)
G28678 NA non-coding upstream 852762 43177802 ~ 43201203 (+)
G28637 NA non-coding upstream 933184 43109050 ~ 43120781 (+)
G28548 NA non-coding upstream 1431808 42621950 ~ 42622157 (+)
G28527 NA non-coding upstream 1467297 42584232 ~ 42586668 (+)
G28956 NA non-coding downstream 634933 44691541 ~ 44749908 (+)
G28991 NA non-coding downstream 712069 44768677 ~ 44816663 (+)
G28995 NA non-coding downstream 739316 44795924 ~ 44798463 (+)
G29148 NA non-coding downstream 1297108 45353716 ~ 45354079 (+)
G29153 NA non-coding downstream 1321403 45378011 ~ 45378353 (+)
AMCG00008132 NA other upstream 748435 43292596 ~ 43305530 (+)
AMCG00008120 NA other upstream 897893 43144805 ~ 43156072 (+)
G28636 LOC105922603,LOC105919618,LOC107100266,LOC103465560,LOC103147358,LOC102223196,LOC106964922,LOC106524088,LOC108244412,LOC107655056 other upstream 945723 43105713 ~ 43108242 (+)
AMCG00008102 prpf6,LOC107673318,LOC107705744,LOC102793577 other upstream 1616737 42413632 ~ 42437228 (+)
G28395 NA other upstream 2060588 41992859 ~ 41993377 (+)
AMCG00008177 rbm38,LOC101475440,LOC103365886,LOC105906784 other downstream 966540 45023148 ~ 45036416 (+)
AMCG00008185 NA other downstream 1090789 45147397 ~ 45171828 (+)
AMCG00008194 acot8,LOC107730625,LOC107670930,LOC107722006 other downstream 1283966 45340574 ~ 45343914 (+)
G29183 NA other downstream 1383905 45440513 ~ 45441064 (+)
G29353 NA other downstream 2211283 46267891 ~ 46268327 (+)

Expression


Co-expression Network