G28977 (cdh4,LOC101161393)


Basic Information

Item Value
gene id G28977
gene name cdh4,LOC101161393
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 44679816 ~ 44680042 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU36277
GAGCCGGGAGATGGTCCAGTTCCGCCTCACGCTGGGGGGGAAGGATGGCAGCTCGAAGACGAAGGGCCCGATGTTGGGGTCGACATCAGAATCGGAGGCAGTGATGTTGATGGAGTTGGTGTTGATCTTCTCGCAGATCTGGGCTTCCTGGGGCAGGAGCTCGGGCGCGTTGTCATTGACGTCAATCAGGTAGATCTGCAGGGTTCCCGTCCCACTGGCTGGGGGAG

Function

symbol description
cdh4 Predicted to enable cadherin binding activity and calcium ion binding activity. Acts upstream of or within cranial nerve development; regulation of eye photoreceptor cell development; and sensory system development. Predicted to be located in plasma membrane. Predicted to be integral component of membrane. Predicted to be part of catenin complex. Is expressed in nervous system. Orthologous to human CDH4 (cadherin 4).

NR:

description
cadherin-4-like isoform X2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU36277 True 227 lncRNA 0.61 1 44679816 44680042

Neighbor

gene id symbol gene type direction distance location
AMCG00008158 NA coding downstream 596968 44073663 ~ 44082848 (-)
AMCG00008159 col9a3 coding downstream 607831 44044933 ~ 44071985 (-)
AMCG00008151 LOC106519038,LOC106571933,LOC103357347,LOC104951675 coding downstream 707516 43962078 ~ 43972300 (-)
AMCG00008152 ncoa3,LOC107090280 coding downstream 757788 43897216 ~ 43922028 (-)
AMCG00008148 mrgbp,LOC106566471 coding downstream 1003439 43666568 ~ 43676377 (-)
AMCG00008164 NA coding upstream 41697 44721739 ~ 44740915 (-)
AMCG00008165 psma7,LOC106571922 coding upstream 69048 44749090 ~ 44752458 (-)
AMCG00008163 NA coding upstream 96611 44776653 ~ 44778533 (-)
AMCG00008166 NA coding upstream 98694 44778736 ~ 44786186 (-)
AMCG00008174 NA coding upstream 115884 44795926 ~ 44814080 (-)
G28974 LOC101069589,LOC106525190,LOC104949831 non-coding downstream 13239 44666343 ~ 44666577 (-)
G28973 NA non-coding downstream 192397 44487210 ~ 44487419 (-)
G28914 NA non-coding downstream 678950 43996118 ~ 44000866 (-)
G28907 NA non-coding downstream 783865 43894179 ~ 43895951 (-)
G28900 NA non-coding downstream 786008 43863607 ~ 43893808 (-)
G28978 NA non-coding upstream 1383 44681425 ~ 44681769 (-)
G28976 NA non-coding upstream 2395 44682437 ~ 44688175 (-)
G29081 NA non-coding upstream 354403 45034445 ~ 45036413 (-)
G29170 NA non-coding upstream 673765 45353807 ~ 45354086 (-)
G29182 NA non-coding upstream 739548 45419590 ~ 45420462 (-)
G28970 NA other downstream 261620 44417874 ~ 44418196 (-)
AMCG00008144 phf20,LOC107727854 other downstream 1096403 43510760 ~ 43583413 (-)
AMCG00008124 LOC105922603,LOC105919618,LOC103147358,LOC106964922,LOC102223196,LOC103465560,LOC107100266,LOC108244412 other downstream 1559652 43097111 ~ 43120164 (-)
G28581 mafba,mafb,LOC107562627,LOC107713570,LOC106535696 other downstream 1915162 42761004 ~ 42764654 (-)
AMCG00008104 samd10 other downstream 2278742 42359900 ~ 42401074 (-)
AMCG00008192 NA other upstream 469459 45149501 ~ 45228504 (-)
G29301 NA other upstream 1370653 46050695 ~ 46054346 (-)
G29361 NA other upstream 1800904 46480946 ~ 46481898 (-)
AMCG00008233 NA other upstream 2900097 47580139 ~ 47607012 (-)
AMCG00008245 si:ch211-199o1.2,LOC105896344,LOC105896343,LOC108441608,LOC107668030,LOC108418094,LOC101067989 other upstream 2986600 47666642 ~ 47918462 (-)

Expression


Co-expression Network