G29419 (znfx1,LOC106583673,LOC107587633,LOC107744348)


Basic Information

Item Value
gene id G29419
gene name znfx1,LOC106583673,LOC107587633,LOC107744348
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 47589513 ~ 47589814 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU36849
GCTGGTGGTCTCCTATGAGAATGAGGTGCTGGCAGGATTGGCTCAGGGTGGTGATGGTGTGGGCCTCTAGCACCTCGGCCGCCTCCTCCACAATCACCAGGCGGGGGCGCACTTCCTGCAGGGCACGGCGGTACTTGGCAGCGCCCGTGGTGGTCATGCCAATGACCCGGGCCTCCTTCAGGATGCACAGGTCCTCCCGCAGACGGATCTCTGCCAGCCGCTCGGCAGCGTCCTGGTAAGCTTGTTCCGAGTGCAGCGCCCGCGCCCGCATGTCAGTCTGGTACCGAGACAGCCACAGCCTG

Function

symbol description
znfx1 Predicted to enable RNA binding activity. Predicted to be involved in heterochromatin assembly by small RNA. Predicted to act upstream of or within regulation of transcription, DNA-templated. Predicted to be located in nucleus. Predicted to be part of nuclear RNA-directed RNA polymerase complex. Orthologous to human ZNFX1 (zinc finger NFX1-type containing 1).

NR:

description
PREDICTED: NFX1-type zinc finger-containing protein 1-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU36849 True 302 lncRNA 0.66 1 47589513 47589814

Neighbor

gene id symbol gene type direction distance location
AMCG00008226 NA coding upstream 1058755 46530450 ~ 46530758 (+)
AMCG00008221 LOC102785565 coding upstream 1458496 46124130 ~ 46131017 (+)
AMCG00008220 NA coding upstream 1498520 46077307 ~ 46090993 (+)
AMCG00008219 NA coding upstream 1520695 46039948 ~ 46068818 (+)
AMCG00008218 NA coding upstream 1677906 45867343 ~ 45911607 (+)
AMCG00008239 NA coding downstream 211284 47801098 ~ 47813090 (+)
AMCG00008243 slc35c2,LOC105890624 coding downstream 306104 47895918 ~ 47908312 (+)
AMCG00008248 NA coding downstream 365220 47955034 ~ 48001940 (+)
AMCG00008247 LOC107565828 coding downstream 425286 48015100 ~ 48030729 (+)
AMCG00008246 NA coding downstream 452932 48042746 ~ 48067543 (+)
G29417 NA non-coding upstream 10872 47577676 ~ 47578641 (+)
G29412 NA non-coding upstream 23960 47565341 ~ 47565553 (+)
G29404 NA non-coding upstream 176947 47412359 ~ 47412566 (+)
G29387 LOC107575789,LOC100846954 non-coding upstream 550621 47038464 ~ 47038892 (+)
G29376 NA non-coding upstream 865618 46723633 ~ 46723895 (+)
G29422 NA non-coding downstream 9420 47599234 ~ 47599468 (+)
G29423 NA non-coding downstream 11006 47600820 ~ 47601101 (+)
G29424 NA non-coding downstream 12404 47602218 ~ 47602686 (+)
G29425 NA non-coding downstream 15326 47605140 ~ 47606425 (+)
G29431 NA non-coding downstream 23687 47613501 ~ 47615931 (+)
G29418 NA other upstream 3278 47580213 ~ 47586235 (+)
G29353 NA other upstream 1321186 46267891 ~ 46268327 (+)
G29183 NA other upstream 2148449 45440513 ~ 45441064 (+)
AMCG00008194 acot8,LOC107730625,LOC107670930,LOC107722006 other upstream 2245599 45340574 ~ 45343914 (+)
AMCG00008185 NA other upstream 2417685 45147397 ~ 45171828 (+)
G29421 NA other downstream 5290 47595104 ~ 47595686 (+)
AMCG00008232 ddx27 other downstream 33138 47622952 ~ 47671421 (+)
AMCG00008238 hsp70l,hsp70.3,LOC105896343,LOC105896344 other downstream 74703 47664517 ~ 47716582 (+)
AMCG00008242 hsp70.2,LOC108441608,LOC105896344,LOC105896343 other downstream 273755 47863569 ~ 47892071 (+)
AMCG00008241 LOC106596195,LOC106601018,LOC105896344,LOC105896343 other downstream 324054 47913868 ~ 47918128 (+)

Expression


Co-expression Network