G30053


Basic Information

Item Value
gene id G30053
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 50267076 ~ 50267435 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU37590
aaggatcctatccagactatttttaaatgttcccaaactttcagcttctaccacatcgctgggtagtttattccagattgtgactactctctgtgtaaagaagtgtctcctgttttctgttttgaatgccttgaagcccaatttccatttgtgtccccgggtgcgtgtgtccctgctgatctggaaaagctcctctggtttgatgtggtcgatgcctttcatgattttgaagacttggatcaagtccccacgtagtctcctcccttcagacctggaataagtctggttgctctcctctgaactgcctctaaagcagcaatatccttcttgaagtgtggtgcccagaactgcacacagtat

Function

GO:

id name namespace
GO:0010605 negative regulation of macromolecule metabolic process biological_process
GO:0016071 mRNA metabolic process biological_process
GO:0010629 negative regulation of gene expression biological_process
GO:0006401 RNA catabolic process biological_process
GO:0006402 mRNA catabolic process biological_process
GO:0009892 negative regulation of metabolic process biological_process
GO:0000956 nuclear-transcribed mRNA catabolic process biological_process
GO:1901361 organic cyclic compound catabolic process biological_process
GO:0044265 cellular macromolecule catabolic process biological_process
GO:0000184 nuclear-transcribed mRNA catabolic process, nonsense-mediated decay biological_process
GO:0044270 cellular nitrogen compound catabolic process biological_process
GO:0046700 heterocycle catabolic process biological_process
GO:0019439 aromatic compound catabolic process biological_process
GO:0034655 nucleobase-containing compound catabolic process biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU37590 True 360 lncRNA 0.46 1 50267076 50267435

Neighbor

gene id symbol gene type direction distance location
AMCG00008287 scrt2,LOC103139108,LOC102228875 coding downstream 111211 50147817 ~ 50155865 (-)
AMCG00008286 NA coding downstream 147770 50116033 ~ 50119306 (-)
AMCG00008285 tcf15,LOC106567197,LOC107669611,LOC107594541 coding downstream 177309 50087093 ~ 50089767 (-)
AMCG00008284 LOC105895941,LOC108424612,LOC108255211,LOC103042686,LOC104930306,LOC103375199,LOC101473264 coding downstream 237456 49996960 ~ 50029620 (-)
AMCG00008282 NA coding downstream 279501 49947011 ~ 49987575 (-)
AMCG00008290 slc52a3 coding upstream 24897 50292332 ~ 50293363 (-)
AMCG00008289 LOC105022328,LOC106572481,LOC107572061,LOC107683645,LOC108425074,LOC103044311 coding upstream 41343 50308778 ~ 50313435 (-)
AMCG00008293 ptpn1,LOC107669644,LOC107751444,LOC107556311,LOC106522952 coding upstream 130304 50397739 ~ 50406216 (-)
AMCG00008295 LOC107738191,LOC107754892,LOC107590469,LOC107558752,LOC106567112 coding upstream 183652 50451087 ~ 50518539 (-)
AMCG00008297 kcng1,LOC102780788,LOC107711602,LOC107558732 coding upstream 282630 50550065 ~ 50559321 (-)
G30051 NA non-coding downstream 5889 50260756 ~ 50261187 (-)
G30049 NA non-coding downstream 15154 50251710 ~ 50251922 (-)
G30003 NA non-coding downstream 81799 50185032 ~ 50185277 (-)
G29987 NA non-coding downstream 140945 50125640 ~ 50126131 (-)
G29957 NA non-coding downstream 292430 49974426 ~ 49974646 (-)
G30058 NA non-coding upstream 46737 50314172 ~ 50314425 (-)
G30059 NA non-coding upstream 60835 50328270 ~ 50334605 (-)
G30061 NA non-coding upstream 86460 50353895 ~ 50356348 (-)
G30065 NA non-coding upstream 118825 50386260 ~ 50386559 (-)
G30070 NA non-coding upstream 178284 50445719 ~ 50448970 (-)
G29974 LOC101154678 other downstream 212974 50053825 ~ 50054102 (-)
G29928 NA other downstream 361987 49795971 ~ 49905089 (-)
AMCG00008273 gdap1l1,LOC107599436,LOC107664149,LOC107594051,LOC107707014 other downstream 729795 49497400 ~ 49537281 (-)
AMCG00008264 NA other downstream 1013832 49175725 ~ 49253244 (-)
AMCG00008255 NA other downstream 1848143 48411085 ~ 48418933 (-)
G30054 NA other upstream 6303 50273738 ~ 50274183 (-)
AMCG00008298 NA other upstream 256552 50523987 ~ 50528036 (-)
AMCG00008318 NA other upstream 2061801 52329236 ~ 52339097 (-)
AMCG00008325 znf341,LOC106566899 other upstream 2113621 52381056 ~ 52384567 (-)

Expression


Co-expression Network