AMCG00008690


Basic Information

Item Value
gene id AMCG00008690
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030126.1
NCBI id CM030126.1
chromosome length 46242406
location 8941500 ~ 8941823 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00008690
ATGAACGCAACGGCGCCGTGGAACCGGACTCTTGCGGACGCGCAGCAGCCCAGGCTGGGGATCGAGGCGCTTCTCCGGTGCTGCAACTTCACCAACTCGGTGATCACGGACGACGGGTTCGGGGTGTCCCTGCCGGACGAGCGGAGCCTGTACATCATGCAGGTGGTGCAGATCGCCGTGCTGTGCGTCCTGTCGCTCACGGTGGTGTTCGGGGTATTTTTCCTGGGCTGCAATCTGCTCATCAAGTCCGAAAGCATGGTCAATCTACTGGTGGAGGACCGCAGAGCGTCCAAAGAAGTGGAAGCTATAATGATCGGGTCATAA

Function

GO:

id name namespace
GO:0016021 integral component of membrane cellular_component
GO:0005737 cytoplasm cellular_component

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00008690 True 324 mRNA 0.60 1 8941500 8941823

Neighbor

gene id symbol gene type direction distance location
AMCG00008691 NA coding downstream 25404 8913938 ~ 8916096 (-)
AMCG00008693 NA coding downstream 39749 8896737 ~ 8901751 (-)
AMCG00008689 NA coding downstream 48977 8882494 ~ 8892523 (-)
AMCG00008687 NA coding downstream 122054 8805776 ~ 8819446 (-)
AMCG00008686 dnajc14,LOC107737354,LOC107683641 coding downstream 140176 8791263 ~ 8801324 (-)
AMCG00008692 NA coding upstream 16455 8958278 ~ 8967884 (-)
AMCG00008694 NA coding upstream 78137 9019960 ~ 9035943 (-)
AMCG00008699 NA coding upstream 95110 9036933 ~ 9067430 (-)
AMCG00008697 rnf41,LOC107723732 coding upstream 140004 9081827 ~ 9102880 (-)
AMCG00008698 LOC105017093,LOC106583345,LOC106565408 coding upstream 208237 9150060 ~ 9170282 (-)
G50836 NA non-coding downstream 100845 8837359 ~ 8840655 (-)
G50784 NA non-coding downstream 367162 8574014 ~ 8574338 (-)
G50740 NA non-coding downstream 557493 8372506 ~ 8384007 (-)
G50736 cdk2,LOC107683630,LOC107570445,LOC107737371,LOC107696023 non-coding downstream 580538 8357450 ~ 8360962 (-)
G50711 NA non-coding downstream 616725 8278752 ~ 8324775 (-)
G50915 NA non-coding upstream 202521 9144344 ~ 9149938 (-)
G50999 NA non-coding upstream 434749 9376572 ~ 9379452 (-)
G51002 NA non-coding upstream 438928 9380751 ~ 9381754 (-)
G51004 NA non-coding upstream 446435 9388258 ~ 9388608 (-)
G51005 NA non-coding upstream 447001 9388824 ~ 9389048 (-)
G50788 NA other downstream 281483 8656728 ~ 8660017 (-)
G50739 NA other downstream 570170 8367916 ~ 8371330 (-)
G50712 tuba1c,LOC108255233,LOC108433351,LOC103467923,LOC106456382,LOC102313992,LOC107707018,LOC107557552,LOC105930792,LOC107697948,LOC102193505 other downstream 647146 8270324 ~ 8294354 (-)
AMCG00008668 LOC106456382,LOC108433351,LOC107714908,LOC103467923,LOC108433416,LOC103367934,LOC102193505,LOC108255233 other downstream 648014 8281215 ~ 8293486 (-)
G50710 NA other downstream 672174 8269023 ~ 8269326 (-)
G51008 NA other upstream 449020 9390843 ~ 9393227 (-)
AMCG00008741 hdac7,LOC107704627,LOC107752451 other upstream 1396502 10338325 ~ 10370316 (-)
AMCG00008744 NA other upstream 1619043 10560866 ~ 10603373 (-)
AMCG00008748 LOC107666380,LOC108429286,LOC107705699,LOC107681386,LOC107559866 other upstream 1729126 10670949 ~ 10718201 (-)
G51241 NA other upstream 1733933 10675756 ~ 10712485 (-)

Expression


Co-expression Network